Strain Name:
C57BL/6J-Adcy5em2Lutzy/Mmjax
Stock Number:
069618-JAX
Citation ID:
RRID:MMRRC_069618-JAX
Other Names:
Adcy5A727T

Strain Information

Adcy5em2Lutzy
Name: adenylate cyclase 5; endonuclease-mediated mutation 2, Cathleen Lutz
Synonyms: Adcy5A727T
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 26
Alteration at locus: CRISPR
Adcy5
Name: adenylate cyclase 5
Synonyms: AC5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: CRISPR
NCBI: 224129
VEGA: 16
HGNC: HGNC:236
Homologene: 11213
Genetic Alterations

The Adcy5em2Lutzy (Adcy5A727T) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. Guide RNAs (TGGGTCGGGCCATCGATGCC and TCGCAGTCTGTCGATGCTCC) were selected to target exon 10 of the adenylate cyclase 5 locus on Chromosome 16. Donor DNAs were created encoding an A727T mutation (GCC to ACA, alanine to threonine).

HVGS Nomenclature
  • Genbank RefSeq - mRNA: NM_001012765.5
  • Genbank RefSeq, protein: NP_001012783.3
  • Variant, nucleic acid level: c.2179_2181delinsACA
  • Variant, amino acid level, predicted: p.Ala727Thr (A727T)
  • Check this variant: LUMC Mutalyzer
ES Cell Line
Not applicable
Phenotype

The Adcy5 (adenylate cyclase 5 gene encodes a membrane-bound adenylyl cyclase involved in the conversion of ATP to cAMP. Mutations in this gene have been associated with type-2 diabetes and ADCY5-related dyskinesia, a disorder characterized by abnormal involuntary movements.

To create the Adcy5A727T allele, CRISPR/Cas9 endonuclease-mediated genome editing of Adyc5 exon 10 was used to introduce an A727T point mutation (alanine to threonine). Homozygous mice are viable and fertile. If additional characterization of Adcy5A727T mice is performed, the donor may modify the strain description accordingly.

Strain Development
The guide RNAs and Cas9 nuclease were introduced into C57BL/6J zygotes and then transferred to pseudopregnant females. Progeny were screened by DNA sequencing of the targeted region and founder 9051 was identified as harboring the desired allele. This founder was bred to C57BL/6J for germline transmission and backcrossed to the same background for at least two generations.
Suggested Control Mice
C57BL/6J
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
  • Diabetes
  • Neurobiology
Donor
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Not ready to publish

Colony and Husbandry Information

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org .
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backcross and sib-mating
Generation
N2 (C57BL/6J), F?
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Bred to Homozygosity
Yes
Average litter size
Undetermined
Recommended wean age
4 Weeks
Average Pups Weaned
Undetermined

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069618-JAX-SPERM Cryo-preserved spermatozoa $437.00 / $437.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
069618-JAX-RESUS Litter recovered from cryo-archive $2,022.00 / $2,022.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.