Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Kmt2aem3Lutzy/Mmjax
Stock Number:
069630-JAX
Citation ID:
RRID:MMRRC_069630-JAX
Other Names:
Kmt2adel414

Strain Information

Kmt2aem3Lutzy
Name: lysine (K)-specific methyltransferase 2A; endonuclease-mediated mutation 3, Cathy Lutz
Synonyms: Kmt2aindel, Kmt2adel414
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: CRISPR
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mouse
Chromosome: 9
Alteration at locus: CRISPR
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Genetic Alterations
Kmt2adel414 is a CRISPR/Cas9 generated mutant of the lysine (K)-specific methyltransferase 2A gene carrying 414 nt deletion resulting in the loss of exon 2 (indel mutation). These mice may be useful in studying Wiedemann-Steiner Syndrome.
ES Cell Line
Not applicable
Phenotype
The Kmt2a (lysine (K)-specific methyltransferase 2A, also known as MLL)) encodes a histone modification enzyme involved in the regulation of gene expression in early development and hematopoiesis. Mutations in Kmt2a are associated with Wiedemann-Steiner Syndrome a condition characterized by developmental delay, short stature, some facial dysmorphia and low muscle tone.

CRISPR/Cas9 endonuclease-mediated genome editing of Kmt2a created a 414 bp deletion in exon 2, resulting in the loss of exon 2 (indel mutation). Heterozygous mice are viable and fertile. In the homozygous state, the mutation is embryonic or perinatal lethal.
Strain Development
The Kmt2aem3Lutzy (Kmt2adel414) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. Guide RNAs upstream (GGACCTGTAGTTTGAAATTC and GAATTTCAAACTACAGGTCC) and downstream (AGTAAGGATGATTGCAGCCC and GCTCACACAGTTTCCTGGCC) of exon 2 were originally designed to introduce loxP sites in the lysine (K)-specific methyltransferase 2A locus on Chromosome 9. These sequences and Cas9 nuclease were introduced into C57BL/6J zygotes, and then transferred to pseudopregnant females. Progeny were screened by DNA sequencing of the targeted region, which identified a 414 bp deletion resulting in the loss of exon (indel mutation). This strain does not contain the loxP sites. This founder was bred to C57BL/6J (Stock No. 000664) for germline transmission. The colony was backcrossed to C57BL/6J for a total of at least two generations.
Suggested Control Mice
C57BL/6J
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
  • Developmental Biology
  • Models for Human Disease
Donor
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Not ready to publish

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backross and sib-mating
Generation
N2 (C57BL/6J), F?
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: No No
Homozygotes are fertile: No No
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Undetermined
Recommended wean age
4 Weeks
Average Pups Weaned
Undetermined

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069630-JAX-SPERM Cryo-preserved spermatozoa $459.00 / $459.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
069630-JAX-RESUS Litter recovered from cryo-archive $2,123.00 / $2,123.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.