Strain Detail Sheet

Strain Name:
C57BL/6-Eprs1em1Pyao/Mmjax
Stock Number:
069688-JAX
Citation ID:
RRID:MMRRC_069688-JAX
Other Names:
Eprs gKO

Strain Information

Gene Details

Eprs1em1Pyao
Name: glutamyl-prolyl-tRNA synthetase 1; endonuclease-mediated mutation 1, Peng Yao
Synonyms: Eprs gKO
Type: Allele
Species: Mus musculus
Chromosome: 1
Alteration at locus: CRISPR
Eprs1
Name: glutamyl-prolyl-tRNA synthetase 1
Synonyms: 3010002K18Rik, Qprs, 2410081F06Rik, Eprs
Type: Gene
Species: Mouse
Chromosome: 1
Alteration at locus: CRISPR
NCBI: 107508
HGNC: HGNC:3418
Homologene: 5870
Genome Browser [Click image to go to Jbrowse]



Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Genetic Alterations
Eprs gKO mice have premature stop codons inserted in exon 3 of the Eprs (glutamyl-prolyl-tRNA synthetase) locus. In the homozygous state, the mutation is embryonic lethal. Heterozygotes are resistant to isoproterenol, myocardial infarction (MI) and transverse aortic constriction (TAC)-induced cardiac fibrosis. These mice be useful in studies of the regulation of profibrotic genes during cardiac fibrosis.
Genotype Determination
ES Cell Line
Not applicable

Strain Description

Phenotype
Eprs (glutamyl-prolyl-tRNA synthetase) encodes a multifunctional aminoacyl-tRNA synthetase that catalyzes the attachment of proline and glutamic acid to cognate tRNAs for protein synthesis. As such, Eprs is involved in the translational control of proline-rich profibrotic genes upregulated in cardiac fibrosis and heart failure.

Eprs gKO mice were created using CRISPR/cas9 genome editing to insert tandem stop codons and a frame-shifting adenosine residue into exon 3 of the Eprs locus resulting in a null allele. Mice heterozygous for the mutation are viable and fertile. In the homozygous state, the mutation is embryonic lethal. Following isoproterenol (ISO) infusion, heterozygous mice developed less cardiac fibrosis then controls. Transverse aortic constriction (TAC) surgery resulted in a 40% reduction of cardiac fibrosis, partially restored cardiac function, and reduced cardiac hypertrophy in heterozygotes as compared to wild-type. Induction of myocardial infarction (MI) with artery ligation surgery also resulted in reduced cardiac fibrosis as compared to controls. These mice be useful in studies of the regulation of profibrotic genes during cardiac fibrosis.
Strain Development
CRISPR/Cas9 endonuclease-mediated genome editing was used to insert tandem stop codons and a frame-shifting adenosine residue (UAAUAAA) into exon 3 of the Eprs locus on chromosome 1. Guide RNA (GCUAGAAUUGCAACUACGUCUGG), a homology-directed recombination DNA template and Cas9 endonuclease were introduced into C57BL/6J-derived fertilized eggs by pronuclear injection. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6J mice for germline transmission. The mutation was confirmed by TA cloning and Sanger sequencing. The strain has been backcrossed to C57BL/6J for more than 10 generations by the donating laboratory (see SNP note below). Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes.

In 2022, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory MMRRC. Two of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating. These data suggest the mice sent to The Jackson Laboratory MMRRC were on a mixed C57BL/6N;C57BL/6J genetic background.

Suggested Control Mice
Wild type C57BL/6J

MMRRC Genetic QC

MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.

Research Applications

  • Cardiovascular
  • Models for Human Disease

Strain Origin

Donor
Peng Yao, Ph.D., Aab CVRI, University of Rochester Medical Center.
Primary Reference

Wu J, Subbaiah KCV, Xie LH, Jiang F, Khor ES, Mickelsen D, Myers JR, Tang WHW, Yao P. Glutamyl-Prolyl-tRNA Synthetase Regulates Proline-Rich Pro-Fibrotic Protein Synthesis During Cardiac Fibrosis. Circ Res. 2020 Aug 28;127(6):827-846. doi: 10.1161/CIRCRESAHA.119.315999. Epub 2020 Jul 1. (Medline PMCID: 7484271)

Colony and Husbandry Information

Special Considerations

N/A

Health Status Report

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.

Appearance

Coat Color
Black
Eye
Black

Breeding

MMRRC Breeding System
Sib-mating
Generation
N>10
Overall Breeding Performance
Excellent

Reproductive Statistics

Viability and Fertility: Female Male Comments
Homozygotes are viable: No No
Homozygotes are fertile: N/A N/A
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: 4 to 6 months 4 to 6 months
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Request Information

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Conditions of Distribution

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*		 Units Notes
069688-JAX-SPERM Cryo-preserved spermatozoa $437.00 / Non-Profit Aliquot Approximate quantity3
069688-JAX-RESUS Litter recovered from cryo-archive $2,022.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.