Strain Name:
C57BL/6J-Scn2aem1Kea/Mmucd
Stock Number:
069700-UCD
Citation ID:
RRID:MMRRC_069700-UCD
Other Names:
Scn2a

Strain Information

Scn2aem1Kea
Name: sodium channel, voltage-gated, type II, alpha; endonuclease-mediated mutation 1, Jennifer Kearney
Synonyms: Scn2aE, Scn2aK1422E
Type: Allele
Species: Mus musculus
Chromosome: 2
Alteration at locus: CRISPR
Scn2a
Name: sodium channel, voltage-gated, type II, alpha
Synonyms: A230052E19Rik, Scn2a1, Nav1.2
Type: Gene
Species: Mouse
Chromosome: 2
Alteration at locus: CRISPR
NCBI: 110876
Homologene: 75001
Genetic Alterations

CRISPR/Cas9 editing was used to introduce a single nucleotide change, resulting in the K1422E missense mutation. This change corresponds to the neurodevelopmental disorder-associated p.K1422E pathogenic variant in humans.

ES Cell Line
Not applicable
Phenotype
Heterozygotes: exhibit rare spontaneous seizures, interictal EEG abnormalities, altered induced seizure thresholds, reduced anxiety-like behavior, and alterations in olfactory-guided social behavior. Additionally, cultured cortical neurons from heterozygotes exhibit lower current density with a TTX-resistant component and reversal potential consistent with mixed ion permeation. The cortical slices from heterozygotes exhibit impaired action potential initiation and larger Ca2+ transients at the axon initial segment during the rising phase of the action potential.
Homozygotes: exhibit perinatal lethality, and complete penetrance.
Strain Development
CRISPR/Cas9 and homology-directed repair were used with sgRNA (TCCTTTAAATGTGGCCTGTA) and repair oligo (5'-CCTTGTTTCCACTTTTACTCTGATAATCTATTTCCTAAACTATAAAAAAGAGAAGAAGTATATATGTTGATTGTTTTACAGGCCACATTTGAAGGATGGATGGATATCATGTATGCAGCTGTTGACTCAAGAAATGTAAGTTTACTTTGG)(NCBI gene ID 110876, NM_001099298.3) with variant c.4447A>G, predicting p.Lys1422Glu (K1422E) was electroporated into 2-cell stage C57BL/6J embryos (RRID:IMSR_000664-JAX). Mating of the confirmed mosaic founders to C57BL/6J (Jackson Lab #000664) for germline transmission was done and then subsequent crossing with B6J for an additional 12 generations.
Suggested Control Mice
wild-type, C57BL/6J
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@ucdavis.edu. Older strains may not have this information.
  • Models for Human Disease
  • Neurobiology
Donor
Jennifer Kearney, Ph.D., Northwestern University.
Primary Reference

Echevarria-Cooper DM, Hawkins NA, Misra SN, Huffman AM, Thaxton T, Thompson CH, Ben-Shalom R, Nelson AD, Lipkin AM, George AL, Bender KJ, Kearney JA. Cellular and behavioral effects of altered NaV1.2 sodium channel ion permeability in Scn2aK1422E mice. Hum Mol Genet. 2022 Apr 13:ddac087. doi: 10.1093/hmg/ddac087. Epub ahead of print. (Medline PMID: 35417922)

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@ucdavis.edu.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backcross
Generation
C57BL/6J = N12
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: Reduced Reduced
Homozygotes are fertile: N/A N/A
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: 4 to 6 months 4 to 6 months
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Gwendolyn Humphreys.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Gwendolyn Humphreys

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069700-UCD-SPERM Cryo-preserved spermatozoa $546.25 / $869.88
Non-Profit / For-Profit
Aliquot Approximate quantity3
069700-UCD-RESUS Litter recovered from cryo-archive $4,044.00 / $7,650.23
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.