Strain Name:
C57BL/6NJ-Mtmr6em1(IMPC)J/Mmjax
Stock Number:
069816-JAX
Citation ID:
RRID:MMRRC_069816-JAX
Major Collection:

Strain Information

Mtmr6em1(IMPC)J
Name: myotubularin related protein 6; endonuclease-mediated mutation 1, Jackson
Type: Allele
Species: Mus musculus
Chromosome:
Alteration at locus: CRISPR
Mtmr6
Name: myotubularin related protein 6
Synonyms: Gm38641, 4022440C11Rik
Type: Gene
Species: Mus musculus
Chromosome: 14
Alteration at locus: CRISPR
NCBI: 219135
VEGA: 14
HGNC: HGNC:7453
Homologene: 55842
Genetic Alterations
intragenic deletion
Genotype Determination
Phenotype
Phenotyping data may be available at mousephenotype.org.
Strain Development
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGCCATTTCTTTGAAGAAG and ACAGTGCTGAGGGCAGTGTG, which resulted in a 277 bp deletion beginning at Chromosome 14 position 60,281,868 bp and ending after 60,282,144 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000558120 (exon 4) and 119 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 101 and early truncation 2 amino acids later. There is a single bp A insertion at the deletion site.
Suggested Control Mice
C57BL/6NJ or wild-type from colony
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
Donor
Stephen Murray, Ph.D., The Jackson Laboratory.

Colony and Husbandry Information

https://www.jax.org/~/media/jaxweb/health-reports/ax9.pdf?la=en

For more information about this colony's health status contact csmmrrc@jax.org
Coat Color
black
Generation
N2F2
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: Undetermined Undetermined
Homozygotes are fertile: Undetermined Undetermined
Heterozygotes are fertile: Undetermined Undetermined
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Undetermined
Average Pups Weaned
Undetermined

Order Request Information

Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.