Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9715Btlr/Mmmh
Stock Number:
069962-MU
Citation ID:
RRID:MMRRC_069962-MU
Other Names:
R9715 (G1)
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
Tfap2b
Name: transcription factor AP-2 beta
Synonyms: AP-2(beta), E130018K07Rik, Tcfap2b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21419
Homologene: 20688
Gpr37l1
Name: G protein-coupled receptor 37-like 1
Synonyms: CAG-18, D0Kist8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 171469
Homologene: 3500
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Slc25a12
Name: solute carrier family 25 (mitochondrial carrier, Aralar), member 12
Synonyms: B230107K20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78830
Homologene: 48235
Ino80e
Name: INO80 complex subunit E
Synonyms: Ccdc95
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233875
Homologene: 17792
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 19,214,149 bp (GRCm38)
  • G to A, chromosome 1 at 87,503,288 bp (GRCm38)
  • A to G, chromosome 1 at 97,749,587 bp (GRCm38)
  • C to T, chromosome 1 at 135,161,653 bp (GRCm38)
  • A to G, chromosome 1 at 155,875,361 bp (GRCm38)
  • C to A, chromosome 2 at 65,748,805 bp (GRCm38)
  • A to T, chromosome 2 at 66,689,558 bp (GRCm38)
  • C to T, chromosome 2 at 71,279,555 bp (GRCm38)
  • T to C, chromosome 2 at 111,270,278 bp (GRCm38)
  • T to C, chromosome 2 at 156,341,627 bp (GRCm38)
  • G to T, chromosome 2 at 178,394,164 bp (GRCm38)
  • T to C, chromosome 3 at 37,714,652 bp (GRCm38)
  • T to G, chromosome 3 at 157,069,299 bp (GRCm38)
  • T to C, chromosome 4 at 21,993,307 bp (GRCm38)
  • C to A, chromosome 4 at 25,620,679 bp (GRCm38)
  • G to T, chromosome 4 at 114,907,998 bp (GRCm38)
  • T to A, chromosome 4 at 116,597,893 bp (GRCm38)
  • G to C, chromosome 5 at 30,483,917 bp (GRCm38)
  • A to T, chromosome 5 at 36,629,685 bp (GRCm38)
  • A to G, chromosome 5 at 36,940,144 bp (GRCm38)
  • A to C, chromosome 5 at 66,999,017 bp (GRCm38)
  • A to G, chromosome 5 at 114,060,108 bp (GRCm38)
  • G to T, chromosome 5 at 137,400,555 bp (GRCm38)
  • G to A, chromosome 6 at 5,045,936 bp (GRCm38)
  • A to G, chromosome 6 at 56,779,581 bp (GRCm38)
  • T to C, chromosome 6 at 91,988,309 bp (GRCm38)
  • CTCTTCATGATTTTCTT to CTCTT, chromosome 6 at 131,301,649 bp (GRCm38)
  • A to T, chromosome 6 at 137,368,110 bp (GRCm38)
  • A to G, chromosome 7 at 12,668,134 bp (GRCm38)
  • A to G, chromosome 7 at 27,391,575 bp (GRCm38)
  • C to T, chromosome 7 at 45,979,935 bp (GRCm38)
  • G to A, chromosome 7 at 107,182,419 bp (GRCm38)
  • A to G, chromosome 7 at 108,255,991 bp (GRCm38)
  • A to T, chromosome 7 at 110,871,433 bp (GRCm38)
  • A to T, chromosome 7 at 126,861,926 bp (GRCm38)
  • G to A, chromosome 8 at 40,795,453 bp (GRCm38)
  • T to A, chromosome 9 at 42,375,300 bp (GRCm38)
  • T to A, chromosome 9 at 83,548,460 bp (GRCm38)
  • T to C, chromosome 9 at 101,971,185 bp (GRCm38)
  • A to G, chromosome 9 at 110,087,650 bp (GRCm38)
  • ACA to ACATCTTCCCAAAGCCAGTCA, chromosome 11 at 3,153,382 bp (GRCm38)
  • C to A, chromosome 11 at 5,282,454 bp (GRCm38)
  • T to C, chromosome 11 at 98,772,117 bp (GRCm38)
  • A to G, chromosome 13 at 95,008,865 bp (GRCm38)
  • A to T, chromosome 14 at 50,844,302 bp (GRCm38)
  • T to A, chromosome 15 at 98,227,021 bp (GRCm38)
  • G to A, chromosome 16 at 44,005,477 bp (GRCm38)
  • A to G, chromosome 16 at 93,685,053 bp (GRCm38)
  • A to G, chromosome 17 at 46,167,375 bp (GRCm38)
  • G to A, chromosome 18 at 36,753,513 bp (GRCm38)
  • T to C, chromosome 18 at 42,573,348 bp (GRCm38)
  • T to C, chromosome 19 at 6,084,044 bp (GRCm38)
  • GATCTCTAT to GAT, chromosome 19 at 9,007,029 bp (GRCm38)
  • C to A, chromosome 19 at 41,103,799 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9715 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069962-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.