Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9715Btlr/Mmmh
Stock Number:
069962-MU
Citation ID:
RRID:MMRRC_069962-MU
Other Names:
R9715 (G1)
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
Tfap2b
Name: transcription factor AP-2 beta
Synonyms: AP-2(beta), E130018K07Rik, Tcfap2b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21419
Homologene: 20688
Gpr37l1
Name: G protein-coupled receptor 37-like 1
Synonyms: CAG-18, D0Kist8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 171469
Homologene: 3500
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Slc25a12
Name: solute carrier family 25 (mitochondrial carrier, Aralar), member 12
Synonyms: B230107K20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78830
Homologene: 48235
Ino80e
Name: INO80 complex subunit E
Synonyms: Ccdc95
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233875
Homologene: 17792
Cep350
Name: centrosomal protein 350
Synonyms: 6430546F08Rik, 4933409L06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74081
Homologene: 8879
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Ik
Name: IK cytokine
Synonyms: MuRED
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 24010
VEGA: 18
HGNC: HGNC:5958
Homologene: 36193
D5Ertd579e
Name: DNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms: 9030221A05Rik, A930018H20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320661
Homologene: 19716
Gramd1c
Name: GRAM domain containing 1C
Synonyms: 4921521N14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207798
Homologene: 129735
Tcerg1
Name: transcription elongation regulator 1 (CA150)
Synonyms: p144, ca150, Taf2s, 2410022J09Rik, 2900090C16Rik, Fbp28
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 56070
Homologene: 4879
Ppip5k2
Name: diphosphoinositol pentakisphosphate kinase 2
Synonyms: Vip2, Hisppd1, Cfap160
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227399
Homologene: 49409
Znrf3
Name: zinc and ring finger 3
Synonyms: LOC382477
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 407821
Homologene: 46592
Kbtbd2
Name: kelch repeat and BTB (POZ) domain containing 2
Synonyms: Bklhd1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 210973
Homologene: 17122
Sh3bgrl2
Name: SH3 domain binding glutamic acid-rich protein like 2
Synonyms: A930014C21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 212531
Homologene: 12876
Nr1d1
Name: nuclear receptor subfamily 1, group D, member 1
Synonyms: rev-erbA(alpha), REV-ERBalpha, A530070C09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217166
HGNC: HGNC:7962
Homologene: 23324
Adam20
Name: a disintegrin and metallopeptidase domain 20
Synonyms: 4930529F22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 384806
Homologene: 128364
Zfpl1
Name: zinc finger like protein 1
Synonyms: 1500015B20Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 81909
Homologene: 4935
Scn7a
Name: sodium channel, voltage-gated, type VII, alpha
Synonyms: Nav2.3, NaG, Nav2, 1110034K09Rik, Scn6a, Nax
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20272
Homologene: 55706
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Ptpro
Name: protein tyrosine phosphatase receptor type O
Synonyms: D28, PTPROt, PTP-phi, PTP-BK, PTP-U2, GLEPP1, PTP-oc, Ptpn15
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19277
HGNC: HGNC:9678
Homologene: 21564
Scn2a
Name: sodium channel, voltage-gated, type II, alpha
Synonyms: Nav1.2, A230052E19Rik, Scn2a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110876
Homologene: 75001
Nlrp14
Name: NLR family, pyrin domain containing 14
Synonyms: 4921520L01Rik, Nalp14, GC-LRR, Nalp-iota
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76858
Homologene: 18531
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Fgd5
Name: FYVE, RhoGEF and PH domain containing 5
Synonyms: ZFYVE23, C330025N11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232237
Homologene: 27798
Ppp2r2c
Name: protein phosphatase 2, regulatory subunit B, gamma
Synonyms: IMYPNO1, PR52, 6330548O06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269643
HGNC: HGNC:9306
Homologene: 36386
Sycp2
Name: synaptonemal complex protein 2
Synonyms: 3830402K23Rik, 4930518F03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320558
Homologene: 8604
Wdr41
Name: WD repeat domain 41
Synonyms: MSTP048, B830029I03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218460
Homologene: 23087
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Abcc6
Name: ATP-binding cassette, sub-family C member 6
Synonyms: DCC, Mrp6, Dyscalc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27421
HGNC: HGNC:57
Homologene: 55559
Ngef
Name: neuronal guanine nucleotide exchange factor
Synonyms: ephexin, Tims2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 53972
HGNC: HGNC:7807
Homologene: 75120
Sfi1
Name: Sfi1 homolog, spindle assembly associated (yeast)
Synonyms: 2310047I15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78887
Homologene: 12707
Dhx30
Name: DExH-box helicase 30
Synonyms: Ddx30, 2810477H02Rik, C130058C04Rik, helG, DEAH (Asp-Glu-Ala-His) box polypeptide 30
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72831
Homologene: 15779
Ephb1
Name: Eph receptor B1
Synonyms: Elk, Hek6, Net, Cek6, Elkh, C130099E04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270190
HGNC: HGNC:3392
Homologene: 20936
Or4k35
Name: olfactory receptor family 4 subfamily K member 35
Synonyms: GA_x6K02T2Q125-72321818-72320907, MOR248-11, Olfr1277
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258391
Homologene: 105176
Faxc
Name: failed axon connections homolog
Synonyms: 6230409E13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76132
Homologene: 32781
Gm5148
Name: predicted gene 5148
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381438
Homologene: 134322
Tll2
Name: tolloid-like 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24087
VEGA: 19
Homologene: 56545
Styk1
Name: serine/threonine/tyrosine kinase 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243659
Homologene: 49545
Svop
Name: SV2 related protein
Synonyms: 1110030H18Rik, msvop
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68666
Homologene: 41283
Fut9
Name: fucosyltransferase 9
Synonyms: mFUT9, mFuc-TIX
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14348
HGNC: HGNC:4020
Homologene: 4800
Irag1
Name: inositol 1,4,5-triphosphate receptor associated 1
Synonyms: Ris1, Mrvi1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17540
HGNC: HGNC:7237
Homologene: 4425
Negr1
Name: neuronal growth regulator 1
Synonyms: Ntra, 5330422G01Rik, neurotractin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320840
Homologene: 41447
Ccdc17
Name: coiled-coil domain containing 17
Synonyms: 1100001F07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 622665
Homologene: 77410
Or10ad1b
Name: olfactory receptor family 10 subfamily AD member 1B
Synonyms: GA_x6K02T2NBG7-5528233-5529186, MOR286-2, EG629524, Olfr286
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 629524
Homologene: 134078
Gtpbp2
Name: GTP binding protein 2
Synonyms: nmf205
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56055
HGNC: HGNC:4670
Homologene: 10420
Or5p64
Name: olfactory receptor family 5 subfamily P member 64
Synonyms: GA_x6K02T2PBJ9-10586187-10585243, MOR204-15, Olfr488
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258727
Homologene: 110483
Cnbd2
Name: cyclic nucleotide binding domain containing 2
Synonyms: 5430421B09Rik, 4921517L17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70873
Homologene: 15440
Foxd2
Name: forkhead box D2
Synonyms: Mf2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17301
HGNC: HGNC:3803
Homologene: 3292
Cimip2c
Name: ciliary microtubule inner protein 2C
Synonyms: 1700001C02Rik, Fam166c
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75434
Homologene: 49920
Cbr3
Name: carbonyl reductase 3
Synonyms: 1110001J05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 109857
HGNC: HGNC:1549
Homologene: 20332
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 19,214,149 bp (GRCm38)
  • G to A, chromosome 1 at 87,503,288 bp (GRCm38)
  • A to G, chromosome 1 at 97,749,587 bp (GRCm38)
  • C to T, chromosome 1 at 135,161,653 bp (GRCm38)
  • A to G, chromosome 1 at 155,875,361 bp (GRCm38)
  • C to A, chromosome 2 at 65,748,805 bp (GRCm38)
  • A to T, chromosome 2 at 66,689,558 bp (GRCm38)
  • C to T, chromosome 2 at 71,279,555 bp (GRCm38)
  • T to C, chromosome 2 at 111,270,278 bp (GRCm38)
  • T to C, chromosome 2 at 156,341,627 bp (GRCm38)
  • G to T, chromosome 2 at 178,394,164 bp (GRCm38)
  • T to C, chromosome 3 at 37,714,652 bp (GRCm38)
  • T to G, chromosome 3 at 157,069,299 bp (GRCm38)
  • T to C, chromosome 4 at 21,993,307 bp (GRCm38)
  • C to A, chromosome 4 at 25,620,679 bp (GRCm38)
  • G to T, chromosome 4 at 114,907,998 bp (GRCm38)
  • T to A, chromosome 4 at 116,597,893 bp (GRCm38)
  • G to C, chromosome 5 at 30,483,917 bp (GRCm38)
  • A to T, chromosome 5 at 36,629,685 bp (GRCm38)
  • A to G, chromosome 5 at 36,940,144 bp (GRCm38)
  • A to C, chromosome 5 at 66,999,017 bp (GRCm38)
  • A to G, chromosome 5 at 114,060,108 bp (GRCm38)
  • G to T, chromosome 5 at 137,400,555 bp (GRCm38)
  • G to A, chromosome 6 at 5,045,936 bp (GRCm38)
  • A to G, chromosome 6 at 56,779,581 bp (GRCm38)
  • T to C, chromosome 6 at 91,988,309 bp (GRCm38)
  • CTCTTCATGATTTTCTT to CTCTT, chromosome 6 at 131,301,649 bp (GRCm38)
  • A to T, chromosome 6 at 137,368,110 bp (GRCm38)
  • A to G, chromosome 7 at 12,668,134 bp (GRCm38)
  • A to G, chromosome 7 at 27,391,575 bp (GRCm38)
  • C to T, chromosome 7 at 45,979,935 bp (GRCm38)
  • G to A, chromosome 7 at 107,182,419 bp (GRCm38)
  • A to G, chromosome 7 at 108,255,991 bp (GRCm38)
  • A to T, chromosome 7 at 110,871,433 bp (GRCm38)
  • A to T, chromosome 7 at 126,861,926 bp (GRCm38)
  • G to A, chromosome 8 at 40,795,453 bp (GRCm38)
  • T to A, chromosome 9 at 42,375,300 bp (GRCm38)
  • T to A, chromosome 9 at 83,548,460 bp (GRCm38)
  • T to C, chromosome 9 at 101,971,185 bp (GRCm38)
  • A to G, chromosome 9 at 110,087,650 bp (GRCm38)
  • ACA to ACATCTTCCCAAAGCCAGTCA, chromosome 11 at 3,153,382 bp (GRCm38)
  • C to A, chromosome 11 at 5,282,454 bp (GRCm38)
  • T to C, chromosome 11 at 98,772,117 bp (GRCm38)
  • A to G, chromosome 13 at 95,008,865 bp (GRCm38)
  • A to T, chromosome 14 at 50,844,302 bp (GRCm38)
  • T to A, chromosome 15 at 98,227,021 bp (GRCm38)
  • G to A, chromosome 16 at 44,005,477 bp (GRCm38)
  • A to G, chromosome 16 at 93,685,053 bp (GRCm38)
  • A to G, chromosome 17 at 46,167,375 bp (GRCm38)
  • G to A, chromosome 18 at 36,753,513 bp (GRCm38)
  • T to C, chromosome 18 at 42,573,348 bp (GRCm38)
  • T to C, chromosome 19 at 6,084,044 bp (GRCm38)
  • GATCTCTAT to GAT, chromosome 19 at 9,007,029 bp (GRCm38)
  • C to A, chromosome 19 at 41,103,799 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9715 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069962-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.