Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9719Btlr/Mmmh
Stock Number:
069966-MU
Citation ID:
RRID:MMRRC_069966-MU
Other Names:
R9719 (G1)
Major Collection:

Strain Information

Elp2
Name: elongator acetyltransferase complex subunit 2
Synonyms: Stat3-interacting protein, StIP1, Statip1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 58523
VEGA: 18
Homologene: 6019
Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: PTP36, C130080N23Rik, OTTMUSG00000022087
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Txn2
Name: thioredoxin 2
Synonyms: 2510006J11Rik, Trx2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56551
Homologene: 40849
Ncaph2
Name: non-SMC condensin II complex, subunit H2
Synonyms: 0610010J20Rik, 2610524G04Rik, D15Ertd785e, Kleisin beta
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 52683
Homologene: 12045
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: E130014J05Rik, Ayu17-449
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214133
Homologene: 49498
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to G, chromosome 1 at 26,683,739 bp (GRCm38)
  • T to A, chromosome 1 at 87,088,414 bp (GRCm38)
  • C to A, chromosome 1 at 179,803,548 bp (GRCm38)
  • G to A, chromosome 1 at 181,187,659 bp (GRCm38)
  • T to A, chromosome 1 at 189,851,287 bp (GRCm38)
  • A to T, chromosome 2 at 22,544,455 bp (GRCm38)
  • A to G, chromosome 2 at 30,175,801 bp (GRCm38)
  • T to A, chromosome 2 at 85,664,264 bp (GRCm38)
  • T to A, chromosome 2 at 88,339,584 bp (GRCm38)
  • T to A, chromosome 2 at 91,938,566 bp (GRCm38)
  • T to C, chromosome 2 at 119,297,072 bp (GRCm38)
  • C to T, chromosome 2 at 127,656,105 bp (GRCm38)
  • T to A, chromosome 2 at 150,269,384 bp (GRCm38)
  • G to A, chromosome 3 at 115,122,442 bp (GRCm38)
  • A to T, chromosome 3 at 133,486,042 bp (GRCm38)
  • A to C, chromosome 4 at 43,781,454 bp (GRCm38)
  • A to G, chromosome 4 at 73,769,865 bp (GRCm38)
  • T to A, chromosome 4 at 134,065,837 bp (GRCm38)
  • A to T, chromosome 5 at 74,225,343 bp (GRCm38)
  • C to A, chromosome 7 at 6,502,000 bp (GRCm38)
  • G to A, chromosome 7 at 12,260,522 bp (GRCm38)
  • A to C, chromosome 7 at 17,757,910 bp (GRCm38)
  • T to C, chromosome 7 at 22,789,906 bp (GRCm38)
  • A to G, chromosome 7 at 45,406,966 bp (GRCm38)
  • T to C, chromosome 7 at 52,014,864 bp (GRCm38)
  • A to G, chromosome 8 at 71,620,812 bp (GRCm38)
  • T to C, chromosome 9 at 20,436,565 bp (GRCm38)
  • G to T, chromosome 9 at 103,254,815 bp (GRCm38)
  • A to G, chromosome 10 at 5,326,601 bp (GRCm38)
  • C to T, chromosome 10 at 77,113,598 bp (GRCm38)
  • A to C, chromosome 11 at 74,289,320 bp (GRCm38)
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp (GRCm38)
  • A to G, chromosome 11 at 101,256,027 bp (GRCm38)
  • A to T, chromosome 11 at 104,977,086 bp (GRCm38)
  • A to T, chromosome 11 at 119,891,114 bp (GRCm38)
  • T to A, chromosome 12 at 8,015,464 bp (GRCm38)
  • T to A, chromosome 12 at 69,185,341 bp (GRCm38)
  • T to C, chromosome 12 at 72,556,265 bp (GRCm38)
  • A to T, chromosome 14 at 103,572,006 bp (GRCm38)
  • T to C, chromosome 15 at 77,928,089 bp (GRCm38)
  • T to C, chromosome 15 at 89,365,323 bp (GRCm38)
  • A to T, chromosome 16 at 85,422,315 bp (GRCm38)
  • A to G, chromosome 16 at 91,659,552 bp (GRCm38)
  • T to C, chromosome 17 at 34,957,491 bp (GRCm38)
  • C to A, chromosome 17 at 78,855,354 bp (GRCm38)
  • A to G, chromosome 18 at 24,622,482 bp (GRCm38)
  • A to G, chromosome 19 at 5,040,488 bp (GRCm38)
  • G to A, chromosome 19 at 10,200,652 bp (GRCm38)
  • A to G, chromosome 19 at 13,480,004 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9719 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069966-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.