Strain Name:
C57BL/6J-MtgxR9719Btlr/Mmmh
Stock Number:
069966-MU
Citation ID:
RRID:MMRRC_069966-MU
Other Names:
R9719 (G1)
Major Collection:

Strain Information

Elp2
Name: elongator acetyltransferase complex subunit 2
Synonyms: StIP1, Statip1, Stat3-interacting protein
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 58523
VEGA: 18
Homologene: 6019
Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: PTP36, OTTMUSG00000022087, C130080N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Txn2
Name: thioredoxin 2
Synonyms: 2510006J11Rik, Trx2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56551
Homologene: 40849
Ncaph2
Name: non-SMC condensin II complex, subunit H2
Synonyms: Kleisin beta, 2610524G04Rik, D15Ertd785e, 0610010J20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 52683
Homologene: 12045
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: Ayu17-449, E130014J05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214133
Homologene: 49498
Zfp26
Name: zinc finger protein 26
Synonyms: Zfp81-rs1, 5033428C05Rik, Zfp-26, mkr-3, Zfp70, KRAB15
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22688
Homologene: 52318
Wdr26
Name: WD repeat domain 26
Synonyms: Gid7, 1600024A01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226757
Homologene: 11857
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: enaptin165, SYNE-1, C130039F11Rik, A330049M09Rik, nesprin-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Vps18
Name: VPS18 CORVET/HOPS core subunit
Synonyms: 9930024E13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228545
Homologene: 13302
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Mal
Name: myelin and lymphocyte protein, T cell differentiation protein
Synonyms: VIP17
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17153
HGNC: HGNC:6817
Homologene: 7827
Olfm3
Name: olfactomedin 3
Synonyms: B230206G02Rik, optimedin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229759
Homologene: 17103
Scfd2
Name: Sec1 family domain containing 2
Synonyms: E430013M20Rik, STXBP1L1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212986
Homologene: 77411
Hspa1b
Name: heat shock protein 1B
Synonyms: Hsp70-1, hsp68, HSP70B1, Hsp70.1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15511
HGNC: HGNC:5233
Homologene: 133785
Rasef
Name: RAS and EF hand domain containing
Synonyms: RAB45
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242505
Homologene: 28424
Colgalt1
Name: collagen beta(1-O)galactosyltransferase 1
Synonyms: Glt25d1, 2810024B22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234407
Homologene: 23465
Pcnx4
Name: pecanex homolog 4
Synonyms: Pcnxl4, 1810048J11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67708
VEGA: 12
Homologene: 23366
Myo3a
Name: myosin IIIA
Synonyms: 9030416P08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 667663
HGNC: HGNC:7601
Homologene: 49486
Or1p1
Name: olfactory receptor family 1 subfamily P member 1
Synonyms: IH3, Olfr59, GA_x6K02T2P1NL-4434429-4435400, MOR133-3P
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18359
HGNC: HGNC:8222
Homologene: 73924
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 105242472
Spata31e2
Name: spermatogenesis associated 31 subfamily E member 2
Synonyms: 4931408C20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210940
Homologene: 86827
Eif2ak2
Name: eukaryotic translation initiation factor 2-alpha kinase 2
Synonyms: Pkr, dsRNA-activated kinase, IFN- type I-induced and dsRNA-activated kinase, IFN-induced and double-stranded RNA-activated kinase, 2310047A08Rik, eIF-2 alpha, 4732414G15Rik, Prkr, Tik, eIF-2 alpha
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19106
HGNC: HGNC:9437
Homologene: 48134
B4gat1
Name: beta-1,4-glucuronyltransferase 1
Synonyms: B3gnt1, 1500032M01Rik, iGNT, BETA3GNT1, B3gnt6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 108902
VEGA: 19
Homologene: 38239
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230806
Homologene: 19232
Dgkz
Name: diacylglycerol kinase zeta
Synonyms: mDGK[z], E130307B02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 104418
HGNC: HGNC:2857
Homologene: 37831
Alppl2
Name: alkaline phosphatase, placental-like 2
Synonyms: Akp5, D1Ertd816e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11650
Homologene: 129600
Inhca
Name: inhibitor of carbonic anhydrase
Synonyms: mICA, 1300017J02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71775
Homologene: 826
Scel
Name: sciellin
Synonyms: 9230114I02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64929
VEGA: 14
Homologene: 2850
Vmn1r81
Name: vomeronasal 1 receptor 81
Synonyms: V1rg9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171244
Homologene: 74327
Kcna7
Name: potassium voltage-gated channel, shaker-related subfamily, member 7
Synonyms: Kv1.7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16495
HGNC: HGNC:6226
Homologene: 7791
Or5b119
Name: olfactory receptor family 5 subfamily B member 119
Synonyms: GA_x6K02T2RE5P-3812807-3811863, MOR202-36, Olfr1475
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258298
Homologene: 77370
Ceacam5
Name: CEA cell adhesion molecule 5
Synonyms: Psg30, 1600029H12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73250
HGNC: HGNC:1819
Homologene: 115938
Spout1
Name: SPOUT domain containing methyltransferase 1
Synonyms: D2Wsu81e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227695
Homologene: 6704
Mgat2
Name: mannoside acetylglucosaminyltransferase 2
Synonyms: GNT2, GNT-II, CDGS2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217664
HGNC: HGNC:7045
Homologene: 1806
Vps25
Name: vacuolar protein sorting 25
Synonyms: 1110020N13Rik, D11Wsu68e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 28084
Homologene: 6303
Vmn1r158
Name: vomeronasal 1 receptor 158
Synonyms: Gm16455
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043067
Homologene: 104166
Krt9
Name: keratin 9
Synonyms: Krt1-9, K9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Gm10518
Name: predicted gene 10518
Type: Gene
Species: Mouse
Chromosome: 1
Or6z1
Name: olfactory receptor family 6 subfamily Z member 1
Synonyms: MOR103-9, GA_x6K02T2QGBW-3232059-3231121, Olfr1348
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258915
Homologene: 17435
Or5g26
Name: olfactory receptor family 5 subfamily G member 26
Synonyms: 912-93, GA_x6K02T2Q125-47143827-47142871, Olfr154, Olfr4-3, MOR175-1, OR93
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27216
Homologene: 104131
Or5d46
Name: olfactory receptor family 5 subfamily D member 46
Synonyms: Olfr1176, GA_x6K02T2Q125-49824309-49825256, MOR174-5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258767
Fen1
Name: flap structure specific endonuclease 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14156
HGNC: HGNC:3650
Homologene: 3034
Cyyr1
Name: cysteine and tyrosine-rich protein 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224405
Homologene: 14191
Or13c7e-ps1
Name: olfactory receptor family 13 subfamily C member 7E, pseudogene 1
Synonyms: Olfr37d, GA_x6K02T2N78B-16154374-16155336, MTPCR52, MOR262-11, Olfr29-ps1, Olfr29, mOR37d
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 29848
Ccdc179
Name: coiled-coil domain containing 179
Synonyms: 1700015G11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100503036
Homologene: 132671
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to G, chromosome 1 at 26,683,739 bp (GRCm38)
  • T to A, chromosome 1 at 87,088,414 bp (GRCm38)
  • C to A, chromosome 1 at 179,803,548 bp (GRCm38)
  • G to A, chromosome 1 at 181,187,659 bp (GRCm38)
  • T to A, chromosome 1 at 189,851,287 bp (GRCm38)
  • A to T, chromosome 2 at 22,544,455 bp (GRCm38)
  • A to G, chromosome 2 at 30,175,801 bp (GRCm38)
  • T to A, chromosome 2 at 85,664,264 bp (GRCm38)
  • T to A, chromosome 2 at 88,339,584 bp (GRCm38)
  • T to A, chromosome 2 at 91,938,566 bp (GRCm38)
  • T to C, chromosome 2 at 119,297,072 bp (GRCm38)
  • C to T, chromosome 2 at 127,656,105 bp (GRCm38)
  • T to A, chromosome 2 at 150,269,384 bp (GRCm38)
  • G to A, chromosome 3 at 115,122,442 bp (GRCm38)
  • A to T, chromosome 3 at 133,486,042 bp (GRCm38)
  • A to C, chromosome 4 at 43,781,454 bp (GRCm38)
  • A to G, chromosome 4 at 73,769,865 bp (GRCm38)
  • T to A, chromosome 4 at 134,065,837 bp (GRCm38)
  • A to T, chromosome 5 at 74,225,343 bp (GRCm38)
  • C to A, chromosome 7 at 6,502,000 bp (GRCm38)
  • G to A, chromosome 7 at 12,260,522 bp (GRCm38)
  • A to C, chromosome 7 at 17,757,910 bp (GRCm38)
  • T to C, chromosome 7 at 22,789,906 bp (GRCm38)
  • A to G, chromosome 7 at 45,406,966 bp (GRCm38)
  • T to C, chromosome 7 at 52,014,864 bp (GRCm38)
  • A to G, chromosome 8 at 71,620,812 bp (GRCm38)
  • T to C, chromosome 9 at 20,436,565 bp (GRCm38)
  • G to T, chromosome 9 at 103,254,815 bp (GRCm38)
  • A to G, chromosome 10 at 5,326,601 bp (GRCm38)
  • C to T, chromosome 10 at 77,113,598 bp (GRCm38)
  • A to C, chromosome 11 at 74,289,320 bp (GRCm38)
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp (GRCm38)
  • A to G, chromosome 11 at 101,256,027 bp (GRCm38)
  • A to T, chromosome 11 at 104,977,086 bp (GRCm38)
  • A to T, chromosome 11 at 119,891,114 bp (GRCm38)
  • T to A, chromosome 12 at 8,015,464 bp (GRCm38)
  • T to A, chromosome 12 at 69,185,341 bp (GRCm38)
  • T to C, chromosome 12 at 72,556,265 bp (GRCm38)
  • A to T, chromosome 14 at 103,572,006 bp (GRCm38)
  • T to C, chromosome 15 at 77,928,089 bp (GRCm38)
  • T to C, chromosome 15 at 89,365,323 bp (GRCm38)
  • A to T, chromosome 16 at 85,422,315 bp (GRCm38)
  • A to G, chromosome 16 at 91,659,552 bp (GRCm38)
  • T to C, chromosome 17 at 34,957,491 bp (GRCm38)
  • C to A, chromosome 17 at 78,855,354 bp (GRCm38)
  • A to G, chromosome 18 at 24,622,482 bp (GRCm38)
  • A to G, chromosome 19 at 5,040,488 bp (GRCm38)
  • G to A, chromosome 19 at 10,200,652 bp (GRCm38)
  • A to G, chromosome 19 at 13,480,004 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9719 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069966-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.