Strain Name:
C57BL/6J-MtgxR9726Btlr/Mmmh
Stock Number:
069972-MU
Citation ID:
RRID:MMRRC_069972-MU
Other Names:
R9726 (G1)
Major Collection:

Strain Information

Sgsm1
Name: small G protein signaling modulator 1
Synonyms: D5Bwg1524e, Rutbc2, 2410098H20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Ggta1
Name: glycoprotein galactosyltransferase alpha 1, 3
Synonyms: Ggta-1, Gal, Ggta, glycoprotein alpha galactosyl transferase 1, GALT, alpha3GalT, alpha Gal
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14594
HGNC: HGNC:4253
Homologene: 7730
Dock9
Name: dedicator of cytokinesis 9
Synonyms: Zizimin1, D14Wsu89e, B230309H04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Lig3
Name: ligase III, DNA, ATP-dependent
Synonyms: D11Wsu78e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16882
HGNC: HGNC:6600
Homologene: 32109
Akap9
Name: A kinase anchor protein 9
Synonyms: G1-448-15, 5730481H23Rik, mei2-5, AKAP450, repro12
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Ago2
Name: argonaute RISC catalytic subunit 2
Synonyms: 2310051F07Rik, 1110029L17Rik, Eif2c2, argonaute 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239528
HGNC: HGNC:3263
Homologene: 81825
Slc44a1
Name: solute carrier family 44, member 1
Synonyms: CHTL1, CTL1, 4833416H08Rik, Cdw92, 2210409B22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100434
Homologene: 11137
Oprm1
Name: opioid receptor, mu 1
Synonyms: Oprm, MOP receptor, muOR, mor, MOP-R, MOR-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18390
HGNC: HGNC:8156
Homologene: 37368
Mlf2
Name: myeloid leukemia factor 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30853
HGNC: HGNC:7126
Homologene: 3968
Cep135
Name: centrosomal protein 135
Synonyms: Cep4, LOC381644
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381644
Homologene: 45709
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: Solo, 6720464I07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Dmxl2
Name: Dmx-like 2
Synonyms: 6430411K14Rik, E130119P06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Cd72
Name: CD72 antigen
Synonyms: Ly-19, Ly-m19, Ly-32, Lyb-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12517
HGNC: HGNC:1696
Homologene: 1350
Apob
Name: apolipoprotein B
Synonyms: apob-48, apob-100
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Fkbp8
Name: FK506 binding protein 8
Synonyms: Fkbp38, 38kDa
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14232
HGNC: HGNC:3724
Homologene: 7720
Zfy1
Name: zinc finger protein 1, Y-linked
Synonyms: Zfy-1
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22767
Homologene: 56456
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, b2b414Clo, Dnchc2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, m152Asp, m407Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Limd1
Name: LIM domains containing 1
Synonyms: D9Ertd192e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 29806
VEGA: 9
HGNC: HGNC:6612
Homologene: 8478
Cul4a
Name: cullin 4A
Synonyms: 2810470J21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 99375
HGNC: HGNC:2554
Homologene: 81724
Dapk1
Name: death associated protein kinase 1
Synonyms: DAP-Kinase, D13Ucla1, 2810425C21Rik, 2310039H24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69635
VEGA: 13
HGNC: HGNC:2674
Homologene: 3626
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Sigirr
Name: single immunoglobulin and toll-interleukin 1 receptor (TIR) domain
Synonyms: Tir8, Sigirr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 24058
Homologene: 36399
Kel
Name: Kell blood group
Synonyms: CD238
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 23925
HGNC: HGNC:6308
Homologene: 362
Rasgef1b
Name: RasGEF domain family, member 1B
Synonyms: 4732452O09Rik, Gpig4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320292
Homologene: 14860
Dock8
Name: dedicator of cytokinesis 8
Synonyms: 1200017A24Rik, A130095G14Rik, 5830472H07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76088
VEGA: 19
Homologene: 52414
Naxe
Name: NAD(P)HX epimerase
Synonyms: APOA1BP, ESTM37, AI-BP, Apoa1bp
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 246703
Homologene: 70948
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Sstr1
Name: somatostatin receptor 1
Synonyms: Smstr1, sst1, Smstr-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20605
Homologene: 820
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1alpha, RIM1a, C030033M19Rik, RIM1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116837
Homologene: 128399
Or6c210
Name: olfactory receptor family 6 subfamily C member 210
Synonyms: MOR114-7, GA_x6K02T2PULF-11338429-11339364, Olfr800
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258541
Homologene: 27203
Atosb
Name: atos homolog B
Synonyms: B230312A22Rik, Fam214b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230088
Homologene: 32625
Krba1
Name: KRAB-A domain containing 1
Synonyms: A930040G15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 77827
Homologene: 15880
Topaz1
Name: testis and ovary specific PAZ domain containing 1
Synonyms: Gm9524
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 671232
VEGA: 9
Homologene: 19835
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: D1Ucla3, 4732433M03Rik, CPSase I, CPS
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Cdcp2
Name: CUB domain containing protein 2
Synonyms: D030010E02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242603
Homologene: 138406
Pip5kl1
Name: phosphatidylinositol-4-phosphate 5-kinase-like 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227733
Homologene: 45457
Serpina3f
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3F
Synonyms: antitrypsin, 2A1, alpha-1 antiproteinasin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238393
HGNC: HGNC:16
Homologene: 115927
Vmn1r185
Name: vomeronasal 1 receptor 185
Synonyms: V1re12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171265
Homologene: 74353
Zfp229
Name: zinc finger protein 229
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381067
Homologene: 136287
Dgki
Name: diacylglycerol kinase, iota
Synonyms: C130010K08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320127
HGNC: HGNC:2855
Homologene: 37956
Cyp2f2
Name: cytochrome P450, family 2, subfamily f, polypeptide 2
Synonyms: Cyp2f
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13107
Homologene: 73898
Oscp1
Name: organic solute carrier partner 1
Synonyms: 1810007P19Rik, 6030436A01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230751
Homologene: 71010
Panx3
Name: pannexin 3
Synonyms: 4833413G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208098
Homologene: 82335
Kcnmb3
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 3
Synonyms: Gm5707
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100502876
HGNC: HGNC:6287
Homologene: 18141
Bex6
Name: brain expressed family member 6
Synonyms: B020003O03Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 328660
Gm13762
Name: predicted gene 13762
Type: Gene
Species: Mouse
Chromosome: 2
Ighv11-1
Name: immunoglobulin heavy variable 11-1
Synonyms: Gm16611
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 780804
Cenpx
Name: centromere protein X
Synonyms: Stra13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20892
Homologene: 88844
0610030E20Rik
Name: RIKEN cDNA 0610030E20 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68364
Homologene: 19243
Zfp658
Name: zinc finger protein 658
Synonyms: Gm7145
Type: Gene
Species: Mouse
Chromosome: 1
Homologene: 88945
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to A, chromosome 1 at 22,630,412 bp (GRCm38)
  • A to T, chromosome 1 at 67,156,236 bp (GRCm38)
  • A to G, chromosome 1 at 117,985,976 bp (GRCm38)
  • T to C, chromosome 2 at 32,583,379 bp (GRCm38)
  • T to C, chromosome 2 at 35,402,410 bp (GRCm38)
  • T to A, chromosome 2 at 88,973,877 bp (GRCm38)
  • A to G, chromosome 3 at 32,482,363 bp (GRCm38)
  • T to C, chromosome 3 at 88,058,412 bp (GRCm38)
  • T to C, chromosome 4 at 43,034,991 bp (GRCm38)
  • T to G, chromosome 4 at 43,452,641 bp (GRCm38)
  • T to C, chromosome 4 at 53,491,410 bp (GRCm38)
  • C to A, chromosome 4 at 107,102,739 bp (GRCm38)
  • C to A, chromosome 4 at 126,076,833 bp (GRCm38)
  • A to G, chromosome 5 at 4,003,757 bp (GRCm38)
  • A to G, chromosome 5 at 76,593,304 bp (GRCm38)
  • T to C, chromosome 5 at 99,234,490 bp (GRCm38)
  • T to C, chromosome 5 at 113,310,552 bp (GRCm38)
  • A to T, chromosome 5 at 121,310,681 bp (GRCm38)
  • T to C, chromosome 6 at 37,299,923 bp (GRCm38)
  • C to T, chromosome 6 at 41,702,037 bp (GRCm38)
  • C to A, chromosome 6 at 48,412,364 bp (GRCm38)
  • T to C, chromosome 6 at 72,348,667 bp (GRCm38)
  • C to T, chromosome 6 at 124,934,658 bp (GRCm38)
  • T to A, chromosome 7 at 26,611,358 bp (GRCm38)
  • C to T, chromosome 7 at 27,121,986 bp (GRCm38)
  • A to G, chromosome 7 at 141,092,210 bp (GRCm38)
  • C to T, chromosome 8 at 13,106,208 bp (GRCm38)
  • A to G, chromosome 8 at 70,534,879 bp (GRCm38)
  • G to A, chromosome 9 at 7,077,999 bp (GRCm38)
  • T to A, chromosome 9 at 37,661,696 bp (GRCm38)
  • A to T, chromosome 9 at 54,415,712 bp (GRCm38)
  • GCAGGGGGATGAGAAGGTA to G, chromosome 9 at 122,774,869 bp (GRCm38)
  • CAGGGGGATGAGAAGGTAAAG to CAG, chromosome 9 at 122,774,870 bp (GRCm38)
  • T to C, chromosome 9 at 123,479,919 bp (GRCm38)
  • T to A, chromosome 10 at 6,979,694 bp (GRCm38)
  • T to C, chromosome 10 at 82,282,771 bp (GRCm38)
  • T to A, chromosome 10 at 86,954,231 bp (GRCm38)
  • A to G, chromosome 10 at 129,660,051 bp (GRCm38)
  • T to C, chromosome 11 at 82,783,594 bp (GRCm38)
  • A to G, chromosome 11 at 120,712,502 bp (GRCm38)
  • T to C, chromosome 12 at 8,006,926 bp (GRCm38)
  • G to A, chromosome 12 at 58,212,698 bp (GRCm38)
  • C to T, chromosome 12 at 104,218,439 bp (GRCm38)
  • T to A, chromosome 12 at 113,982,003 bp (GRCm38)
  • T to C, chromosome 13 at 60,751,134 bp (GRCm38)
  • A to C, chromosome 14 at 121,597,737 bp (GRCm38)
  • G to T, chromosome 15 at 27,912,666 bp (GRCm38)
  • T to C, chromosome 15 at 73,127,070 bp (GRCm38)
  • A to T, chromosome 16 at 32,186,425 bp (GRCm38)
  • T to A, chromosome 17 at 21,746,373 bp (GRCm38)
  • T to A, chromosome 19 at 25,177,010 bp (GRCm38)
  • A to G, chromosome Y at 725,476 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9726 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069972-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.