Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9726Btlr/Mmmh
Stock Number:
069972-MU
Citation ID:
RRID:MMRRC_069972-MU
Other Names:
R9726 (G1)
Major Collection:

Strain Information

Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Ggta1
Name: glycoprotein galactosyltransferase alpha 1, 3
Synonyms: GALT, alpha Gal, Gal, glycoprotein alpha galactosyl transferase 1, alpha3GalT, Ggta-1, Ggta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14594
HGNC: HGNC:4253
Homologene: 7730
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Lig3
Name: ligase III, DNA, ATP-dependent
Synonyms: D11Wsu78e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16882
HGNC: HGNC:6600
Homologene: 32109
Akap9
Name: A kinase anchor protein 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Ago2
Name: argonaute RISC catalytic subunit 2
Synonyms: argonaute 2, 1110029L17Rik, 2310051F07Rik, Eif2c2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239528
HGNC: HGNC:3263
Homologene: 81825
Slc44a1
Name: solute carrier family 44, member 1
Synonyms: CHTL1, CTL1, 4833416H08Rik, Cdw92, 2210409B22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100434
Homologene: 11137
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to A, chromosome 1 at 22,630,412 bp (GRCm38)
  • A to T, chromosome 1 at 67,156,236 bp (GRCm38)
  • A to G, chromosome 1 at 117,985,976 bp (GRCm38)
  • T to C, chromosome 2 at 32,583,379 bp (GRCm38)
  • T to C, chromosome 2 at 35,402,410 bp (GRCm38)
  • T to A, chromosome 2 at 88,973,877 bp (GRCm38)
  • A to G, chromosome 3 at 32,482,363 bp (GRCm38)
  • T to C, chromosome 3 at 88,058,412 bp (GRCm38)
  • T to C, chromosome 4 at 43,034,991 bp (GRCm38)
  • T to G, chromosome 4 at 43,452,641 bp (GRCm38)
  • T to C, chromosome 4 at 53,491,410 bp (GRCm38)
  • C to A, chromosome 4 at 107,102,739 bp (GRCm38)
  • C to A, chromosome 4 at 126,076,833 bp (GRCm38)
  • A to G, chromosome 5 at 4,003,757 bp (GRCm38)
  • A to G, chromosome 5 at 76,593,304 bp (GRCm38)
  • T to C, chromosome 5 at 99,234,490 bp (GRCm38)
  • T to C, chromosome 5 at 113,310,552 bp (GRCm38)
  • A to T, chromosome 5 at 121,310,681 bp (GRCm38)
  • T to C, chromosome 6 at 37,299,923 bp (GRCm38)
  • C to T, chromosome 6 at 41,702,037 bp (GRCm38)
  • C to A, chromosome 6 at 48,412,364 bp (GRCm38)
  • T to C, chromosome 6 at 72,348,667 bp (GRCm38)
  • C to T, chromosome 6 at 124,934,658 bp (GRCm38)
  • T to A, chromosome 7 at 26,611,358 bp (GRCm38)
  • C to T, chromosome 7 at 27,121,986 bp (GRCm38)
  • A to G, chromosome 7 at 141,092,210 bp (GRCm38)
  • C to T, chromosome 8 at 13,106,208 bp (GRCm38)
  • A to G, chromosome 8 at 70,534,879 bp (GRCm38)
  • G to A, chromosome 9 at 7,077,999 bp (GRCm38)
  • T to A, chromosome 9 at 37,661,696 bp (GRCm38)
  • A to T, chromosome 9 at 54,415,712 bp (GRCm38)
  • GCAGGGGGATGAGAAGGTA to G, chromosome 9 at 122,774,869 bp (GRCm38)
  • CAGGGGGATGAGAAGGTAAAG to CAG, chromosome 9 at 122,774,870 bp (GRCm38)
  • T to C, chromosome 9 at 123,479,919 bp (GRCm38)
  • T to A, chromosome 10 at 6,979,694 bp (GRCm38)
  • T to C, chromosome 10 at 82,282,771 bp (GRCm38)
  • T to A, chromosome 10 at 86,954,231 bp (GRCm38)
  • A to G, chromosome 10 at 129,660,051 bp (GRCm38)
  • T to C, chromosome 11 at 82,783,594 bp (GRCm38)
  • A to G, chromosome 11 at 120,712,502 bp (GRCm38)
  • T to C, chromosome 12 at 8,006,926 bp (GRCm38)
  • G to A, chromosome 12 at 58,212,698 bp (GRCm38)
  • C to T, chromosome 12 at 104,218,439 bp (GRCm38)
  • T to A, chromosome 12 at 113,982,003 bp (GRCm38)
  • T to C, chromosome 13 at 60,751,134 bp (GRCm38)
  • A to C, chromosome 14 at 121,597,737 bp (GRCm38)
  • G to T, chromosome 15 at 27,912,666 bp (GRCm38)
  • T to C, chromosome 15 at 73,127,070 bp (GRCm38)
  • A to T, chromosome 16 at 32,186,425 bp (GRCm38)
  • T to A, chromosome 17 at 21,746,373 bp (GRCm38)
  • T to A, chromosome 19 at 25,177,010 bp (GRCm38)
  • A to G, chromosome Y at 725,476 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9726 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069972-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.