Strain Name:
C57BL/6J-MtgxR9728Btlr/Mmmh
Stock Number:
069974-MU
Citation ID:
RRID:MMRRC_069974-MU
Other Names:
R9728 (G1)
Major Collection:

Strain Information

Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: ne, 6030440P17Rik, my, 8430406N05Rik, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Myo1e
Name: myosin IE
Synonyms: 2310020N23Rik, 9130023P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71602
VEGA: 9
HGNC: HGNC:7599
Homologene: 55864
Esco2
Name: establishment of sister chromatid cohesion N-acetyltransferase 2
Synonyms: D030072L07Rik, 2410004I17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71988
Homologene: 12432
Zfp13
Name: zinc finger protein 13
Synonyms: Krox-8, Zfp-13
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22654
VEGA: 17
Homologene: 2580
Sik3
Name: SIK family kinase 3
Synonyms: 9030204A07Rik, 5730525O22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70661
Homologene: 57023
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Mcm5
Name: minichromosome maintenance complex component 5
Synonyms: Cdc46, Mcmd5, mCD46
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17218
HGNC: HGNC:6948
Homologene: 4904
Caml
Name: calcium modulating ligand
Synonyms: Caml
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12328
HGNC: HGNC:1471
Homologene: 1323
Zfp318
Name: zinc finger protein 318
Synonyms: TZF, D530032D06Rik, 2610034E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57908
Homologene: 22808
Unc45a
Name: unc-45 myosin chaperone A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101869
Homologene: 32423
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, D630001M17Rik, LOC381026, 9330188B09Rik, 4921513O20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74369
Homologene: 46535
Lgr6
Name: leucine-rich repeat-containing G protein-coupled receptor 6
Synonyms: A530037C04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329252
Homologene: 49680
Synrg
Name: synergin, gamma
Synonyms: Ap1gbp1, L71-5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217030
HGNC: HGNC:557
Homologene: 105680
Copg1
Name: coatomer protein complex, subunit gamma 1
Synonyms: D6Wsu16e, Copg, D6Ertd71e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54161
HGNC: HGNC:2236
Homologene: 56745
Knop1
Name: lysine rich nucleolar protein 1
Synonyms: 2310008H09Rik, Tsg118
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66356
Homologene: 49729
Tubb6
Name: tubulin, beta 6 class V
Synonyms: 2310057H16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67951
VEGA: 18
Homologene: 69414
Egln1
Name: egl-9 family hypoxia-inducible factor 1
Synonyms: SM-20, Hif-p4h-2, ORF13, Phd2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 112405
HGNC: HGNC:1232
Homologene: 56936
Sec24b
Name: SEC24 homolog B, COPII coat complex component
Synonyms: SEC24
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99683
Homologene: 55968
Pprc1
Name: peroxisome proliferative activated receptor, gamma, coactivator-related 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226169
Homologene: 9006
Sema4a
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A
Synonyms: SemB, SemB, Semab
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20351
Homologene: 8425
Vav1
Name: vav 1 oncogene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22324
Homologene: 3961
Hps3
Name: HPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonyms: Hermansky-Pudlak syndrome 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12807
Homologene: 13019
Miox
Name: myo-inositol oxygenase
Synonyms: C85427, 0610009I10Rik, RSOR, Aldrl6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56727
Homologene: 9732
Nlrp9a
Name: NLR family, pyrin domain containing 9A
Synonyms: Nalp-theta, Nalp9a, D7Ertd565e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233001
Homologene: 116072
Ralgps1
Name: Ral GEF with PH domain and SH3 binding motif 1
Synonyms: RALGEF2, RALGPS1A, 5830418G11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241308
Homologene: 65163
Gm4884
Name: predicted gene 4884
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233164
Syde1
Name: synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Synonyms: mSYD1A, 1200008N06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71709
VEGA: 10
Homologene: 13195
Kcna10
Name: potassium voltage-gated channel, shaker-related subfamily, member 10
Synonyms: Kcna8, Kv1.8
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242151
HGNC: HGNC:6219
Homologene: 4054
Vwf
Name: Von Willebrand factor
Synonyms: B130011O06Rik, 6820430P06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22371
Homologene: 466
Or14a259
Name: olfactory receptor family 14 subfamily A member 259
Synonyms: GA_x6K02T2NHDJ-9744055-9745014, MOR219-2, Olfr305
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258609
Homologene: 128128
Gm19410
Name: predicted gene, 19410
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100502846
Homologene: 132117
Gcc1
Name: golgi coiled coil 1
Synonyms: 4932417P04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74375
Homologene: 11567
Spag16
Name: sperm associated antigen 16
Synonyms: 4921511D23Rik, 4930524F24Rik, Pf20, Wdr29, 4930585K05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66722
Homologene: 11572
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Or5m13
Name: olfactory receptor family 5 subfamily M member 13
Synonyms: Olfr1025, MOR196-6_p, MOR196-5P, GA_x6K02T2Q125-47397266-47398205
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258083
Trbv15
Name: T cell receptor beta, variable 15
Synonyms: Tcrb-V12, Gm16775
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100124679
Cwh43
Name: cell wall biogenesis 43 C-terminal homolog
Synonyms: C130090K23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231293
Homologene: 5474
Vmn1r214
Name: vomeronasal 1 receptor 214
Synonyms: V1rh5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171248
Homologene: 110880
Rgs22
Name: regulator of G-protein signalling 22
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 626596
Homologene: 75047
Vmn2r112
Name: vomeronasal 2, receptor 112
Synonyms: EG628185
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 628185
Homologene: 86604
Pde11a
Name: phosphodiesterase 11A
Synonyms: A630086N24Rik, 6330414F14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241489
HGNC: HGNC:8773
Homologene: 56763
Disc1
Name: disrupted in schizophrenia 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244667
HGNC: HGNC:2888
Homologene: 10257
Slc23a2
Name: solute carrier family 23 (nucleobase transporters), member 2
Synonyms: SVCT2, Slc23a1, YSPL3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54338
Homologene: 68440
Sun5
Name: Sad1 and UNC84 domain containing 5
Synonyms: Spag4l, 1700021O15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76407
Homologene: 12640
Klhdc9
Name: kelch domain containing 9
Synonyms: ESTM31, 1190002J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68874
Homologene: 66637
Or8u8
Name: olfactory receptor family 8 subfamily U member 8
Synonyms: IE6, MOR185-6, GA_x6K02T2Q125-47650922-47649963, Olfr52
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18352
Homologene: 105200
Zfp9
Name: zinc finger protein 9
Synonyms: 1810048F22Rik, Krox-4, Zfp-9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22750
Homologene: 49280
Sapcd2
Name: suppressor APC domain containing 2
Synonyms: 2010317E24Rik, 6030458L21Rik, ang
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72080
Homologene: 18664
Slc14a1
Name: solute carrier family 14 (urea transporter), member 1
Synonyms: 2610507K20Rik, UT-B, 3021401A05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108052
Homologene: 9285
Gpr160
Name: G protein-coupled receptor 160
Synonyms: 1700025D19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71862
Homologene: 8659
Igkv12-46
Name: immunoglobulin kappa variable 12-46
Synonyms: Gm16849
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 692245
Tdpoz6
Name: TD and POZ domain containing 6
Synonyms: Gm37596, Gm9107
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 668325
Defb1
Name: defensin beta 1
Synonyms: mBD-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13214
HGNC: HGNC:2766
Homologene: 3822
Iqcf5
Name: IQ motif containing F5
Synonyms: 1700007L12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75470
Homologene: 20043
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 69,923,683 bp (GRCm38)
  • A to G, chromosome 1 at 134,987,507 bp (GRCm38)
  • A to G, chromosome 1 at 171,359,789 bp (GRCm38)
  • C to A, chromosome 2 at 25,372,657 bp (GRCm38)
  • C to T, chromosome 2 at 33,273,614 bp (GRCm38)
  • C to A, chromosome 2 at 76,291,264 bp (GRCm38)
  • A to G, chromosome 2 at 85,918,543 bp (GRCm38)
  • A to T, chromosome 2 at 86,181,292 bp (GRCm38)
  • G to T, chromosome 2 at 132,058,210 bp (GRCm38)
  • T to A, chromosome 2 at 153,867,546 bp (GRCm38)
  • C to A, chromosome 3 at 20,010,964 bp (GRCm38)
  • A to G, chromosome 3 at 30,895,995 bp (GRCm38)
  • C to T, chromosome 3 at 53,656,631 bp (GRCm38)
  • T to C, chromosome 3 at 88,440,880 bp (GRCm38)
  • A to T, chromosome 3 at 93,692,500 bp (GRCm38)
  • A to T, chromosome 3 at 107,194,197 bp (GRCm38)
  • A to G, chromosome 3 at 129,996,773 bp (GRCm38)
  • A to T, chromosome 5 at 73,408,286 bp (GRCm38)
  • G to T, chromosome 5 at 144,789,383 bp (GRCm38)
  • T to C, chromosome 6 at 28,420,545 bp (GRCm38)
  • A to T, chromosome 6 at 41,141,616 bp (GRCm38)
  • G to A, chromosome 6 at 48,455,773 bp (GRCm38)
  • G to T, chromosome 6 at 69,764,983 bp (GRCm38)
  • A to G, chromosome 6 at 87,902,243 bp (GRCm38)
  • G to T, chromosome 6 at 113,151,405 bp (GRCm38)
  • G to T, chromosome 6 at 118,466,890 bp (GRCm38)
  • C to A, chromosome 6 at 125,591,707 bp (GRCm38)
  • T to A, chromosome 7 at 26,557,490 bp (GRCm38)
  • A to T, chromosome 7 at 41,043,265 bp (GRCm38)
  • G to T, chromosome 7 at 80,328,700 bp (GRCm38)
  • A to G, chromosome 7 at 86,363,563 bp (GRCm38)
  • C to T, chromosome 7 at 118,852,617 bp (GRCm38)
  • A to G, chromosome 8 at 21,794,470 bp (GRCm38)
  • A to G, chromosome 8 at 35,780,440 bp (GRCm38)
  • C to T, chromosome 8 at 75,117,540 bp (GRCm38)
  • G to A, chromosome 8 at 124,948,354 bp (GRCm38)
  • A to T, chromosome 8 at 125,233,056 bp (GRCm38)
  • A to G, chromosome 9 at 46,194,844 bp (GRCm38)
  • A to G, chromosome 9 at 70,316,642 bp (GRCm38)
  • G to T, chromosome 9 at 89,091,342 bp (GRCm38)
  • G to A, chromosome 9 at 95,914,997 bp (GRCm38)
  • A to T, chromosome 9 at 106,515,969 bp (GRCm38)
  • AGCCCGAAAACACGGGGCTCTGC to AGC, chromosome 10 at 78,588,804 bp (GRCm38)
  • A to G, chromosome 11 at 84,024,291 bp (GRCm38)
  • T to C, chromosome 13 at 23,034,837 bp (GRCm38)
  • T to A, chromosome 13 at 55,631,857 bp (GRCm38)
  • A to T, chromosome 14 at 65,831,620 bp (GRCm38)
  • A to T, chromosome 15 at 36,040,710 bp (GRCm38)
  • G to A, chromosome 15 at 82,081,897 bp (GRCm38)
  • A to T, chromosome 15 at 89,334,500 bp (GRCm38)
  • A to G, chromosome 15 at 91,734,025 bp (GRCm38)
  • G to A, chromosome 17 at 22,605,127 bp (GRCm38)
  • C to T, chromosome 17 at 23,580,814 bp (GRCm38)
  • G to A, chromosome 17 at 46,396,787 bp (GRCm38)
  • A to G, chromosome 17 at 57,305,459 bp (GRCm38)
  • A to G, chromosome 18 at 67,401,601 bp (GRCm38)
  • C to A, chromosome 18 at 78,109,592 bp (GRCm38)
  • T to C, chromosome 19 at 46,072,200 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9728 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069974-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.