Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9728Btlr/Mmmh
Stock Number:
069974-MU
Citation ID:
RRID:MMRRC_069974-MU
Other Names:
R9728 (G1)
Major Collection:

Strain Information

Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Myo1e
Name: myosin IE
Synonyms: 2310020N23Rik, 9130023P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71602
VEGA: 9
HGNC: HGNC:7599
Homologene: 55864
Esco2
Name: establishment of sister chromatid cohesion N-acetyltransferase 2
Synonyms: D030072L07Rik, 2410004I17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71988
Homologene: 12432
Zfp13
Name: zinc finger protein 13
Synonyms: Krox-8, Zfp-13
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22654
VEGA: 17
Homologene: 2580
Sik3
Name: SIK family kinase 3
Synonyms: 5730525O22Rik, 9030204A07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70661
Homologene: 57023
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 69,923,683 bp (GRCm38)
  • A to G, chromosome 1 at 134,987,507 bp (GRCm38)
  • A to G, chromosome 1 at 171,359,789 bp (GRCm38)
  • C to A, chromosome 2 at 25,372,657 bp (GRCm38)
  • C to T, chromosome 2 at 33,273,614 bp (GRCm38)
  • C to A, chromosome 2 at 76,291,264 bp (GRCm38)
  • A to G, chromosome 2 at 85,918,543 bp (GRCm38)
  • A to T, chromosome 2 at 86,181,292 bp (GRCm38)
  • G to T, chromosome 2 at 132,058,210 bp (GRCm38)
  • T to A, chromosome 2 at 153,867,546 bp (GRCm38)
  • C to A, chromosome 3 at 20,010,964 bp (GRCm38)
  • A to G, chromosome 3 at 30,895,995 bp (GRCm38)
  • C to T, chromosome 3 at 53,656,631 bp (GRCm38)
  • T to C, chromosome 3 at 88,440,880 bp (GRCm38)
  • A to T, chromosome 3 at 93,692,500 bp (GRCm38)
  • A to T, chromosome 3 at 107,194,197 bp (GRCm38)
  • A to G, chromosome 3 at 129,996,773 bp (GRCm38)
  • A to T, chromosome 5 at 73,408,286 bp (GRCm38)
  • G to T, chromosome 5 at 144,789,383 bp (GRCm38)
  • T to C, chromosome 6 at 28,420,545 bp (GRCm38)
  • A to T, chromosome 6 at 41,141,616 bp (GRCm38)
  • G to A, chromosome 6 at 48,455,773 bp (GRCm38)
  • G to T, chromosome 6 at 69,764,983 bp (GRCm38)
  • A to G, chromosome 6 at 87,902,243 bp (GRCm38)
  • G to T, chromosome 6 at 113,151,405 bp (GRCm38)
  • G to T, chromosome 6 at 118,466,890 bp (GRCm38)
  • C to A, chromosome 6 at 125,591,707 bp (GRCm38)
  • T to A, chromosome 7 at 26,557,490 bp (GRCm38)
  • A to T, chromosome 7 at 41,043,265 bp (GRCm38)
  • G to T, chromosome 7 at 80,328,700 bp (GRCm38)
  • A to G, chromosome 7 at 86,363,563 bp (GRCm38)
  • C to T, chromosome 7 at 118,852,617 bp (GRCm38)
  • A to G, chromosome 8 at 21,794,470 bp (GRCm38)
  • A to G, chromosome 8 at 35,780,440 bp (GRCm38)
  • C to T, chromosome 8 at 75,117,540 bp (GRCm38)
  • G to A, chromosome 8 at 124,948,354 bp (GRCm38)
  • A to T, chromosome 8 at 125,233,056 bp (GRCm38)
  • A to G, chromosome 9 at 46,194,844 bp (GRCm38)
  • A to G, chromosome 9 at 70,316,642 bp (GRCm38)
  • G to T, chromosome 9 at 89,091,342 bp (GRCm38)
  • G to A, chromosome 9 at 95,914,997 bp (GRCm38)
  • A to T, chromosome 9 at 106,515,969 bp (GRCm38)
  • AGCCCGAAAACACGGGGCTCTGC to AGC, chromosome 10 at 78,588,804 bp (GRCm38)
  • A to G, chromosome 11 at 84,024,291 bp (GRCm38)
  • T to C, chromosome 13 at 23,034,837 bp (GRCm38)
  • T to A, chromosome 13 at 55,631,857 bp (GRCm38)
  • A to T, chromosome 14 at 65,831,620 bp (GRCm38)
  • A to T, chromosome 15 at 36,040,710 bp (GRCm38)
  • G to A, chromosome 15 at 82,081,897 bp (GRCm38)
  • A to T, chromosome 15 at 89,334,500 bp (GRCm38)
  • A to G, chromosome 15 at 91,734,025 bp (GRCm38)
  • G to A, chromosome 17 at 22,605,127 bp (GRCm38)
  • C to T, chromosome 17 at 23,580,814 bp (GRCm38)
  • G to A, chromosome 17 at 46,396,787 bp (GRCm38)
  • A to G, chromosome 17 at 57,305,459 bp (GRCm38)
  • A to G, chromosome 18 at 67,401,601 bp (GRCm38)
  • C to A, chromosome 18 at 78,109,592 bp (GRCm38)
  • T to C, chromosome 19 at 46,072,200 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9728 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069974-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.