Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9731Btlr/Mmmh
Stock Number:
069977-MU
Citation ID:
RRID:MMRRC_069977-MU
Other Names:
R9731 (G1)
Major Collection:

Strain Information

Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Sema6d
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Synonyms: 1110067B02Rik, Sema6D-6, Sema6D-5, Sema6D-4, Sema6D-2, Sema6D-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214968
Homologene: 16195
Fgf8
Name: fibroblast growth factor 8
Synonyms: Fgf-8, Aigf
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14179
HGNC: HGNC:3686
Homologene: 7715
Rgs14
Name: regulator of G-protein signaling 14
Synonyms: Rap1/rap2 interacting protein
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 51791
HGNC: HGNC:9996
Homologene: 4735
Slc44a2
Name: solute carrier family 44, member 2
Synonyms: 1110028E10Rik, CTL2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68682
VEGA: 9
Homologene: 10711
Gdi2
Name: GDP dissociation inhibitor 2
Synonyms: GDI beta, GDI-B, GDIB, Gdi3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14569
VEGA: 13
HGNC: HGNC:4227
Homologene: 37488
Srpk1
Name: serine/arginine-rich protein specific kinase 1
Synonyms: SR protein-specific kinase 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20815
Homologene: 110962
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 2 at 28,676,474 bp (GRCm38)
  • A to G, chromosome 2 at 32,945,440 bp (GRCm38)
  • T to A, chromosome 2 at 89,943,972 bp (GRCm38)
  • G to A, chromosome 2 at 124,664,197 bp (GRCm38)
  • C to T, chromosome 2 at 140,170,887 bp (GRCm38)
  • C to T, chromosome 2 at 152,459,413 bp (GRCm38)
  • T to A, chromosome 3 at 72,928,210 bp (GRCm38)
  • T to C, chromosome 3 at 158,175,251 bp (GRCm38)
  • T to G, chromosome 4 at 109,505,721 bp (GRCm38)
  • A to T, chromosome 5 at 25,372,958 bp (GRCm38)
  • A to G, chromosome 5 at 28,339,244 bp (GRCm38)
  • G to A, chromosome 5 at 72,782,096 bp (GRCm38)
  • G to A, chromosome 5 at 100,694,156 bp (GRCm38)
  • C to T, chromosome 5 at 120,620,742 bp (GRCm38)
  • T to C, chromosome 5 at 122,987,760 bp (GRCm38)
  • C to T, chromosome 5 at 134,504,762 bp (GRCm38)
  • G to T, chromosome 6 at 73,191,606 bp (GRCm38)
  • G to A, chromosome 6 at 149,068,640 bp (GRCm38)
  • C to T, chromosome 7 at 31,125,171 bp (GRCm38)
  • A to T, chromosome 7 at 42,903,937 bp (GRCm38)
  • T to C, chromosome 7 at 45,308,630 bp (GRCm38)
  • T to A, chromosome 7 at 46,020,236 bp (GRCm38)
  • G to A, chromosome 7 at 75,136,320 bp (GRCm38)
  • T to G, chromosome 7 at 107,097,579 bp (GRCm38)
  • A to C, chromosome 7 at 114,060,358 bp (GRCm38)
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp (GRCm38)
  • C to A, chromosome 8 at 11,561,649 bp (GRCm38)
  • G to A, chromosome 8 at 45,397,907 bp (GRCm38)
  • G to T, chromosome 8 at 56,089,023 bp (GRCm38)
  • A to T, chromosome 8 at 56,298,356 bp (GRCm38)
  • C to T, chromosome 8 at 75,117,540 bp (GRCm38)
  • CT to C, chromosome 8 at 104,182,032 bp (GRCm38)
  • C to A, chromosome 8 at 119,771,271 bp (GRCm38)
  • C to A, chromosome 8 at 124,902,965 bp (GRCm38)
  • T to C, chromosome 9 at 7,141,166 bp (GRCm38)
  • T to C, chromosome 9 at 15,333,966 bp (GRCm38)
  • T to A, chromosome 9 at 21,352,474 bp (GRCm38)
  • A to T, chromosome 9 at 38,047,596 bp (GRCm38)
  • C to T, chromosome 9 at 67,919,244 bp (GRCm38)
  • A to G, chromosome 9 at 95,865,039 bp (GRCm38)
  • T to C, chromosome 9 at 104,009,170 bp (GRCm38)
  • T to A, chromosome 9 at 108,499,686 bp (GRCm38)
  • T to C, chromosome 9 at 108,565,959 bp (GRCm38)
  • T to A, chromosome 10 at 40,930,735 bp (GRCm38)
  • T to A, chromosome 10 at 69,212,849 bp (GRCm38)
  • A to T, chromosome 10 at 100,510,542 bp (GRCm38)
  • G to T, chromosome 10 at 107,899,467 bp (GRCm38)
  • G to A, chromosome 11 at 69,747,217 bp (GRCm38)
  • C to A, chromosome 11 at 89,015,565 bp (GRCm38)
  • C to T, chromosome 11 at 94,338,424 bp (GRCm38)
  • G to T, chromosome 11 at 110,134,198 bp (GRCm38)
  • G to A, chromosome 11 at 118,988,325 bp (GRCm38)
  • C to T, chromosome 12 at 16,688,597 bp (GRCm38)
  • T to C, chromosome 12 at 100,495,424 bp (GRCm38)
  • A to G, chromosome 13 at 3,538,299 bp (GRCm38)
  • T to C, chromosome 13 at 30,877,250 bp (GRCm38)
  • T to A, chromosome 13 at 55,380,971 bp (GRCm38)
  • C to A, chromosome 13 at 55,459,827 bp (GRCm38)
  • C to T, chromosome 14 at 120,022,682 bp (GRCm38)
  • C to T, chromosome 15 at 100,578,325 bp (GRCm38)
  • T to C, chromosome 17 at 28,328,620 bp (GRCm38)
  • A to G, chromosome 17 at 28,606,323 bp (GRCm38)
  • A to G, chromosome 17 at 46,963,145 bp (GRCm38)
  • C to A, chromosome 18 at 78,109,592 bp (GRCm38)
  • ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG to ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG, chromosome 18 at 80,089,825 bp (GRCm38)
  • T to G, chromosome 18 at 84,095,003 bp (GRCm38)
  • G to A, chromosome 19 at 7,926,761 bp (GRCm38)
  • G to A, chromosome 19 at 42,806,387 bp (GRCm38)
  • T to C, chromosome 19 at 45,742,407 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9731 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069977-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.