Strain Name:
C57BL/6J-MtgxR9741Btlr/Mmmh
Stock Number:
069987-MU
Citation ID:
RRID:MMRRC_069987-MU
Other Names:
R9741 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, DRP, Dmdl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Dlg1
Name: discs large MAGUK scaffold protein 1
Synonyms: Dlgh1, SAP97, B130052P05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13383
HGNC: HGNC:2900
Homologene: 20869
Srpk1
Name: serine/arginine-rich protein specific kinase 1
Synonyms: SR protein-specific kinase 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20815
Homologene: 110962
Dock9
Name: dedicator of cytokinesis 9
Synonyms: Zizimin1, B230309H04Rik, D14Wsu89e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Urb2
Name: URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382038
Homologene: 8859
Ect2
Name: ect2 oncogene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13605
HGNC: HGNC:3155
Homologene: 7298
Iars1
Name: isoleucyl-tRNA synthetase 1
Synonyms: E430001P04Rik, Iars, 2510016L12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Ppp1r10
Name: protein phosphatase 1, regulatory subunit 10
Synonyms: 2610025H06Rik, D17Ertd808e, PNUTS
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52040
HGNC: HGNC:9284
Homologene: 2033
Htr1a
Name: 5-hydroxytryptamine (serotonin) receptor 1A
Synonyms: 5-HT1A receptor, Gpcr18
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15550
VEGA: 13
HGNC: HGNC:5286
Homologene: 20148
Apoc3
Name: apolipoprotein C-III
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11814
HGNC: HGNC:610
Homologene: 136634
Syt14
Name: synaptotagmin XIV
Synonyms: B230320I09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329324
Homologene: 17719
Ghsr
Name: growth hormone secretagogue receptor
Synonyms: Ghsr1a, C530020I22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 208188
HGNC: HGNC:4267
Homologene: 57161
Rhou
Name: ras homolog family member U
Synonyms: 2310026M05Rik, Arhu, mG28K, WRCH-1, CDC42L1, WRCH1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69581
Homologene: 49663
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: Plc, perlecan, Pcn, per
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Znrf2
Name: zinc and ring finger 2
Synonyms: D6Ertd365e, 1190002C14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387524
Homologene: 15668
Fbxw11
Name: F-box and WD-40 domain protein 11
Synonyms: HOS, 2310065A07Rik, Fbxw1b, BTRCP2, BTRC2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103583
Homologene: 76444
Cblb
Name: Casitas B-lineage lymphoma b
Synonyms: Cbl-b
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208650
VEGA: 16
HGNC: HGNC:1542
Homologene: 15856
Ppp1r13l
Name: protein phosphatase 1, regulatory subunit 13 like
Synonyms: IASPP, wa3, NFkB interacting protein 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 333654
Homologene: 84635
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Armh4
Name: armadillo-like helical domain containing 4
Synonyms: 3632451O06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67419
Homologene: 12127
Bbs5
Name: Bardet-Biedl syndrome 5
Synonyms: 1700049I01Rik, 2700023J09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72569
HGNC: HGNC:970
Homologene: 12471
Arhgap20
Name: Rho GTPase activating protein 20
Synonyms: 6530403F17Rik, A530023E23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244867
Homologene: 18938
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Dbn1
Name: drebrin 1
Synonyms: drebrin E2, drebrin A
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56320
HGNC: HGNC:2695
Homologene: 3236
Lrrc37
Name: leucine rich repeat containing 37
Synonyms: Gm884, LOC380730
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380730
Homologene: 134511
Arhgef11
Name: Rho guanine nucleotide exchange factor 11
Synonyms: Prg, PDZ-RhoGEF
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213498
Homologene: 11409
Vmn2r59
Name: vomeronasal 2, receptor 59
Synonyms: EG628444
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 628444
Homologene: 129683
Slc9a3
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms: 9030624O13Rik, NHE3, NHE-3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105243
VEGA: 13
Homologene: 55804
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Axdnd1
Name: axonemal dynein light chain domain containing 1
Synonyms: LOC381304, 9430070O13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77352
Homologene: 52328
Ankrd6
Name: ankyrin repeat domain 6
Synonyms: diversin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140577
Homologene: 8967
Or52z1
Name: olfactory receptor family 52 subfamily Z member 1
Synonyms: Olfr67, 3'[b]1, MOR31-1, GA_x6K02T2PBJ9-6515150-6514170
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18368
Homologene: 85930
Or2d2
Name: olfactory receptor family 2 subfamily D member 2
Synonyms: MOR260-1, GA_x6K02T2PBJ9-9479517-9478573, Olfr715
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258776
HGNC: HGNC:8244
Homologene: 81541
Proser2
Name: proline and serine rich 2
Synonyms: 5430407P10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227545
Homologene: 51648
Btbd6
Name: BTB domain containing 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 399566
VEGA: 12
Homologene: 41967
H1f10
Name: H1.10 linker histone
Synonyms: LOC243529, H1fx, H1X, H1-10
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243529
HGNC: HGNC:4722
Homologene: 4397
Gcsam
Name: germinal center associated, signaling and motility
Synonyms: M17, Gcet2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14525
Homologene: 49157
Snx21
Name: sorting nexin family member 21
Synonyms: 5730407K14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 101113
Homologene: 43132
Cyp2ab1
Name: cytochrome P450, family 2, subfamily ab, polypeptide 1
Synonyms: EG224044
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224044
Homologene: 120487
Rprml
Name: reprimo-like
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104582
Homologene: 66105
Ighv7-3
Name: immunoglobulin heavy variable 7-3
Synonyms: Gm16842
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 629822
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 135,967,645 bp (GRCm38)
  • T to A, chromosome 1 at 156,341,815 bp (GRCm38)
  • A to T, chromosome 1 at 192,984,141 bp (GRCm38)
  • G to A, chromosome 2 at 6,100,769 bp (GRCm38)
  • A to T, chromosome 2 at 41,112,288 bp (GRCm38)
  • A to G, chromosome 2 at 69,654,351 bp (GRCm38)
  • C to T, chromosome 2 at 112,646,926 bp (GRCm38)
  • C to T, chromosome 2 at 164,792,311 bp (GRCm38)
  • A to T, chromosome 3 at 27,102,458 bp (GRCm38)
  • G to A, chromosome 3 at 27,374,749 bp (GRCm38)
  • T to C, chromosome 3 at 87,687,849 bp (GRCm38)
  • T to A, chromosome 4 at 32,860,339 bp (GRCm38)
  • T to C, chromosome 4 at 137,512,651 bp (GRCm38)
  • T to C, chromosome 6 at 54,878,385 bp (GRCm38)
  • A to G, chromosome 6 at 87,981,218 bp (GRCm38)
  • C to T, chromosome 7 at 19,369,800 bp (GRCm38)
  • T to A, chromosome 7 at 42,058,785 bp (GRCm38)
  • G to T, chromosome 7 at 103,787,734 bp (GRCm38)
  • A to G, chromosome 7 at 107,129,159 bp (GRCm38)
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp (GRCm38)
  • A to G, chromosome 8 at 123,654,175 bp (GRCm38)
  • G to T, chromosome 8 at 124,029,012 bp (GRCm38)
  • G to T, chromosome 9 at 46,234,700 bp (GRCm38)
  • T to A, chromosome 9 at 51,849,430 bp (GRCm38)
  • T to A, chromosome 10 at 12,826,820 bp (GRCm38)
  • T to C, chromosome 11 at 8,947,224 bp (GRCm38)
  • G to T, chromosome 11 at 32,735,358 bp (GRCm38)
  • T to C, chromosome 11 at 103,613,429 bp (GRCm38)
  • T to A, chromosome 11 at 103,650,031 bp (GRCm38)
  • T to A, chromosome 12 at 112,977,303 bp (GRCm38)
  • C to T, chromosome 12 at 114,153,375 bp (GRCm38)
  • T to G, chromosome 13 at 49,691,502 bp (GRCm38)
  • C to T, chromosome 13 at 55,476,301 bp (GRCm38)
  • T to A, chromosome 13 at 74,158,875 bp (GRCm38)
  • T to C, chromosome 13 at 105,445,353 bp (GRCm38)
  • A to G, chromosome 14 at 49,770,624 bp (GRCm38)
  • A to T, chromosome 14 at 121,640,104 bp (GRCm38)
  • G to A, chromosome 16 at 20,314,203 bp (GRCm38)
  • T to A, chromosome 16 at 31,857,917 bp (GRCm38)
  • T to C, chromosome 16 at 45,615,956 bp (GRCm38)
  • T to C, chromosome 16 at 52,112,127 bp (GRCm38)
  • G to A, chromosome 17 at 28,599,678 bp (GRCm38)
  • G to A, chromosome 17 at 35,926,439 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9741 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069987-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.