Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9741Btlr/Mmmh
Stock Number:
069987-MU
Citation ID:
RRID:MMRRC_069987-MU
Other Names:
R9741 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Dlg1
Name: discs large MAGUK scaffold protein 1
Synonyms: B130052P05Rik, SAP97, Dlgh1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13383
HGNC: HGNC:2900
Homologene: 20869
Srpk1
Name: serine/arginine-rich protein specific kinase 1
Synonyms: SR protein-specific kinase 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20815
Homologene: 110962
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Urb2
Name: URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382038
Homologene: 8859
Ect2
Name: epithelial cell transforming 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13605
HGNC: HGNC:3155
Homologene: 7298
Iars1
Name: isoleucyl-tRNA synthetase 1
Synonyms: E430001P04Rik, 2510016L12Rik, Iars
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 135,967,645 bp (GRCm38)
  • T to A, chromosome 1 at 156,341,815 bp (GRCm38)
  • A to T, chromosome 1 at 192,984,141 bp (GRCm38)
  • G to A, chromosome 2 at 6,100,769 bp (GRCm38)
  • A to T, chromosome 2 at 41,112,288 bp (GRCm38)
  • A to G, chromosome 2 at 69,654,351 bp (GRCm38)
  • C to T, chromosome 2 at 112,646,926 bp (GRCm38)
  • C to T, chromosome 2 at 164,792,311 bp (GRCm38)
  • A to T, chromosome 3 at 27,102,458 bp (GRCm38)
  • G to A, chromosome 3 at 27,374,749 bp (GRCm38)
  • T to C, chromosome 3 at 87,687,849 bp (GRCm38)
  • T to A, chromosome 4 at 32,860,339 bp (GRCm38)
  • T to C, chromosome 4 at 137,512,651 bp (GRCm38)
  • T to C, chromosome 6 at 54,878,385 bp (GRCm38)
  • A to G, chromosome 6 at 87,981,218 bp (GRCm38)
  • C to T, chromosome 7 at 19,369,800 bp (GRCm38)
  • T to A, chromosome 7 at 42,058,785 bp (GRCm38)
  • G to T, chromosome 7 at 103,787,734 bp (GRCm38)
  • A to G, chromosome 7 at 107,129,159 bp (GRCm38)
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp (GRCm38)
  • A to G, chromosome 8 at 123,654,175 bp (GRCm38)
  • G to T, chromosome 8 at 124,029,012 bp (GRCm38)
  • G to T, chromosome 9 at 46,234,700 bp (GRCm38)
  • T to A, chromosome 9 at 51,849,430 bp (GRCm38)
  • T to A, chromosome 10 at 12,826,820 bp (GRCm38)
  • T to C, chromosome 11 at 8,947,224 bp (GRCm38)
  • G to T, chromosome 11 at 32,735,358 bp (GRCm38)
  • T to C, chromosome 11 at 103,613,429 bp (GRCm38)
  • T to A, chromosome 11 at 103,650,031 bp (GRCm38)
  • T to A, chromosome 12 at 112,977,303 bp (GRCm38)
  • C to T, chromosome 12 at 114,153,375 bp (GRCm38)
  • T to G, chromosome 13 at 49,691,502 bp (GRCm38)
  • C to T, chromosome 13 at 55,476,301 bp (GRCm38)
  • T to A, chromosome 13 at 74,158,875 bp (GRCm38)
  • T to C, chromosome 13 at 105,445,353 bp (GRCm38)
  • A to G, chromosome 14 at 49,770,624 bp (GRCm38)
  • A to T, chromosome 14 at 121,640,104 bp (GRCm38)
  • G to A, chromosome 16 at 20,314,203 bp (GRCm38)
  • T to A, chromosome 16 at 31,857,917 bp (GRCm38)
  • T to C, chromosome 16 at 45,615,956 bp (GRCm38)
  • T to C, chromosome 16 at 52,112,127 bp (GRCm38)
  • G to A, chromosome 17 at 28,599,678 bp (GRCm38)
  • G to A, chromosome 17 at 35,926,439 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9741 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069987-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.