Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9780Btlr/Mmmh
Stock Number:
070025-MU
Citation ID:
RRID:MMRRC_070025-MU
Other Names:
R9780 (G1)
Major Collection:

Strain Information

Hpcal1
Name: hippocalcin-like 1
Synonyms: Vnsl3, visinin like 3, VILIP3, Nvp3, neural visinin-like 3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 53602
VEGA: 12
HGNC: HGNC:5145
Homologene: 37586
Mga
Name: MAX gene associated
Synonyms: Mga, Mad5, C130042M01Rik, D030062C11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29808
Homologene: 49351
Pcf11
Name: PCF11 cleavage and polyadenylation factor subunit
Synonyms: 5730417B17Rik, 2500001H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74737
Homologene: 32282
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Nfkbil1
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor like 1
Synonyms: Def-7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18038
HGNC: HGNC:7800
Homologene: 3671
Fam117a
Name: family with sequence similarity 117, member A
Synonyms: 5730593F17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 215512
Homologene: 12775
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 191,822,626 bp (GRCm38)
  • A to T, chromosome 2 at 3,489,704 bp (GRCm38)
  • A to T, chromosome 2 at 26,377,007 bp (GRCm38)
  • G to A, chromosome 2 at 28,675,749 bp (GRCm38)
  • A to G, chromosome 2 at 29,126,987 bp (GRCm38)
  • A to T, chromosome 2 at 76,943,945 bp (GRCm38)
  • A to T, chromosome 2 at 76,954,691 bp (GRCm38)
  • A to G, chromosome 2 at 87,903,082 bp (GRCm38)
  • A to G, chromosome 2 at 119,916,772 bp (GRCm38)
  • C to T, chromosome 2 at 132,252,874 bp (GRCm38)
  • A to T, chromosome 2 at 145,876,631 bp (GRCm38)
  • G to A, chromosome 2 at 152,994,103 bp (GRCm38)
  • C to A, chromosome 2 at 156,011,244 bp (GRCm38)
  • A to T, chromosome 2 at 180,036,546 bp (GRCm38)
  • T to A, chromosome 3 at 30,598,727 bp (GRCm38)
  • A to G, chromosome 3 at 75,038,052 bp (GRCm38)
  • T to C, chromosome 3 at 153,876,705 bp (GRCm38)
  • T to A, chromosome 4 at 11,513,442 bp (GRCm38)
  • G to A, chromosome 4 at 43,697,193 bp (GRCm38)
  • T to C, chromosome 4 at 141,029,245 bp (GRCm38)
  • T to C, chromosome 6 at 24,604,234 bp (GRCm38)
  • T to A, chromosome 6 at 30,545,537 bp (GRCm38)
  • T to C, chromosome 6 at 108,510,834 bp (GRCm38)
  • G to A, chromosome 7 at 19,507,483 bp (GRCm38)
  • A to G, chromosome 7 at 32,210,436 bp (GRCm38)
  • A to G, chromosome 7 at 84,305,218 bp (GRCm38)
  • A to T, chromosome 7 at 92,664,105 bp (GRCm38)
  • G to C, chromosome 7 at 101,900,329 bp (GRCm38)
  • A to G, chromosome 7 at 103,840,417 bp (GRCm38)
  • A to G, chromosome 7 at 103,893,424 bp (GRCm38)
  • A to G, chromosome 7 at 120,312,224 bp (GRCm38)
  • A to T, chromosome 7 at 144,655,621 bp (GRCm38)
  • T to C, chromosome 8 at 110,887,111 bp (GRCm38)
  • A to G, chromosome 9 at 9,059,101 bp (GRCm38)
  • A to G, chromosome 9 at 44,336,688 bp (GRCm38)
  • A to G, chromosome 9 at 58,499,598 bp (GRCm38)
  • T to C, chromosome 10 at 81,305,196 bp (GRCm38)
  • T to C, chromosome 10 at 81,646,362 bp (GRCm38)
  • T to A, chromosome 10 at 103,189,963 bp (GRCm38)
  • G to A, chromosome 11 at 20,242,142 bp (GRCm38)
  • G to A, chromosome 11 at 49,444,187 bp (GRCm38)
  • A to T, chromosome 11 at 61,159,243 bp (GRCm38)
  • A to C, chromosome 11 at 78,502,177 bp (GRCm38)
  • A to T, chromosome 11 at 95,377,483 bp (GRCm38)
  • A to T, chromosome 11 at 101,741,577 bp (GRCm38)
  • A to G, chromosome 11 at 106,335,409 bp (GRCm38)
  • A to G, chromosome 12 at 17,786,493 bp (GRCm38)
  • G to A, chromosome 12 at 24,514,819 bp (GRCm38)
  • G to T, chromosome 12 at 103,451,202 bp (GRCm38)
  • T to C, chromosome 13 at 67,517,122 bp (GRCm38)
  • T to A, chromosome 13 at 96,947,440 bp (GRCm38)
  • A to T, chromosome 13 at 112,726,057 bp (GRCm38)
  • C to A, chromosome 14 at 31,640,562 bp (GRCm38)
  • C to A, chromosome 14 at 55,075,037 bp (GRCm38)
  • T to A, chromosome 14 at 59,228,347 bp (GRCm38)
  • G to A, chromosome 14 at 75,123,060 bp (GRCm38)
  • T to C, chromosome 14 at 75,202,738 bp (GRCm38)
  • A to G, chromosome 15 at 8,228,639 bp (GRCm38)
  • A to G, chromosome 15 at 76,297,740 bp (GRCm38)
  • T to C, chromosome 16 at 14,246,749 bp (GRCm38)
  • T to A, chromosome 16 at 44,218,818 bp (GRCm38)
  • A to G, chromosome 17 at 3,685,985 bp (GRCm38)
  • C to A, chromosome 17 at 35,220,922 bp (GRCm38)
  • A to G, chromosome 17 at 90,623,614 bp (GRCm38)
  • T to A, chromosome 18 at 15,453,164 bp (GRCm38)
  • T to G, chromosome 18 at 43,241,984 bp (GRCm38)
  • T to G, chromosome 19 at 38,620,690 bp (GRCm38)
  • A to T, chromosome 19 at 60,777,960 bp (GRCm38)
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9780 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
070025-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.