Strain Name:
C57BL/6J-MtgxR9780Btlr/Mmmh
Stock Number:
070025-MU
Citation ID:
RRID:MMRRC_070025-MU
Other Names:
R9780 (G1)
Major Collection:

Strain Information

Hpcal1
Name: hippocalcin-like 1
Synonyms: visinin like 3, VILIP3, Vnsl3, Nvp3, neural visinin-like 3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 53602
VEGA: 12
HGNC: HGNC:5145
Homologene: 37586
Mga
Name: MAX gene associated
Synonyms: Mad5, D030062C11Rik, Mga, C130042M01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29808
Homologene: 49351
Pcf11
Name: PCF11 cleavage and polyadenylation factor subunit
Synonyms: 5730417B17Rik, 2500001H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74737
Homologene: 32282
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Nfkbil1
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor like 1
Synonyms: Def-7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18038
HGNC: HGNC:7800
Homologene: 3671
Fam117a
Name: family with sequence similarity 117, member A
Synonyms: 5730593F17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 215512
Homologene: 12775
Setx
Name: senataxin
Synonyms: Als4, A930037J23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66185
Homologene: 41043
Psma7
Name: proteasome subunit alpha 7
Synonyms: C6-I
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26444
HGNC: HGNC:9536
Homologene: 105299
Rcbtb1
Name: regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Synonyms: 5430409I18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71330
Homologene: 10061
Pip5k1c
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
Synonyms: PIP5KIgamma
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18717
HGNC: HGNC:8996
Homologene: 69032
Cep68
Name: centrosomal protein 68
Synonyms: 6030463E10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216543
Homologene: 65235
Eif3a
Name: eukaryotic translation initiation factor 3, subunit A
Synonyms: A830012B05Rik, Eif3s10, Eif3, Csma
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13669
VEGA: 19
HGNC: HGNC:3271
Homologene: 2779
Usp22
Name: ubiquitin specific peptidase 22
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216825
Homologene: 52664
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: Itpr-1, opt, wblo, InsP3R type I, Pcp-1, Ip3r, IP3R1, Pcp1, P400
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Arhgap42
Name: Rho GTPase activating protein 42
Synonyms: 9030420J04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71544
Homologene: 28446
Dhx8
Name: DEAH-box helicase 8
Synonyms: RNA helicase, mDEAH6, Ddx8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217207
HGNC: HGNC:2749
Homologene: 3628
Taf1b
Name: TATA-box binding protein associated factor, RNA polymerase I, B
Synonyms: mTAFI68, A230108M10Rik, 4930408G01Rik, p63
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 21340
VEGA: 12
Homologene: 31331
Tomt
Name: transmembrane O-methyltransferase
Synonyms: F930017I19Rik, Comt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 791260
Homologene: 19664
Zfp87
Name: zinc finger protein 87
Synonyms: Zfp72, 4631412O18Rik, 2210039O17Rik, Mzf22, KRAB4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 170763
Slc38a9
Name: solute carrier family 38, member 9
Synonyms: 4833412L08Rik, 6720411P22Rik, 9430067K09Rik, 9130023D20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268706
VEGA: 13
Homologene: 18139
Tsc1
Name: TSC complex subunit 1
Synonyms: hamartin, tuberous sclerosis 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64930
Homologene: 314
Zfhx2
Name: zinc finger homeobox 2
Synonyms: zfh-5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239102
Homologene: 52657
Chst9
Name: carbohydrate sulfotransferase 9
Synonyms: GalNAc4ST-2, 5430438D01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71367
Homologene: 12861
Scn4a
Name: sodium channel, voltage-gated, type IV, alpha
Synonyms: SkM1, mH2, Nav1.4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 110880
Homologene: 283
Usf3
Name: upstream transcription factor family member 3
Synonyms: 5530400K22Rik, Gm608, LOC207806, LOC385650
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207806
Homologene: 19504
Hmbs
Name: hydroxymethylbilane synthase
Synonyms: Uros1, Ups, PBGD, porphobilinogen deaminase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15288
VEGA: 9
HGNC: HGNC:4982
Homologene: 158
Ttn
Name: titin
Synonyms: connectin, shru, D330041I19Rik, 2310057K23Rik, mdm, D830007G01Rik, 2310074I15Rik, 1100001C23Rik, 2310036G12Rik, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Msh4
Name: mutS homolog 4
Synonyms: mMsh4, 4930485C04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 55993
HGNC: HGNC:7327
Homologene: 1830
Lmod2
Name: leiomodin 2 (cardiac)
Synonyms: C-Lmod
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93677
HGNC: HGNC:6648
Homologene: 28302
Stk32a
Name: serine/threonine kinase 32A
Synonyms: A930015B13Rik, YANK1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269019
VEGA: 18
Homologene: 65357
Fcsk
Name: fucose kinase
Synonyms: Fuk, 1110046B12Rik, L-fucose kinase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234730
Homologene: 15452
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: SM2, smMHC, SM1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Snapc4
Name: small nuclear RNA activating complex, polypeptide 4
Synonyms: 5730436L13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227644
Homologene: 2321
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: 2410089E03Rik, Jbts17, b2b012Clo, Hug
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Actrt3
Name: actin related protein T3
Synonyms: Arpm1, 1700119I24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76652
Homologene: 13038
Arnt2
Name: aryl hydrocarbon receptor nuclear translocator 2
Synonyms: bHLHe1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11864
Homologene: 7230
Rin2
Name: Ras and Rab interactor 2
Synonyms: RASSF4, 2010003K16Rik, 4632403N06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74030
Homologene: 32430
Oplah
Name: 5-oxoprolinase (ATP-hydrolysing)
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75475
HGNC: HGNC:8149
Homologene: 90938
Nox3
Name: NADPH oxidase 3
Synonyms: het, nmf250
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224480
HGNC: HGNC:7890
Homologene: 49435
Lrriq1
Name: leucine-rich repeats and IQ motif containing 1
Synonyms: 4930503E15Rik, LOC380658, Gm1557
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74978
Homologene: 46007
Ttll9
Name: tubulin tyrosine ligase-like family, member 9
Synonyms: 4930509O20Rik, 1700016F23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74711
Homologene: 41769
Plce1
Name: phospholipase C, epsilon 1
Synonyms: 4933403A21Rik, PLCepsilon
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74055
Homologene: 9478
Abca14
Name: ATP-binding cassette, sub-family A member 14
Synonyms: 4930539G24Rik, 1700110B15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67928
Homologene: 86128
Or13e8
Name: olfactory receptor family 13 subfamily E member 8
Synonyms: GA_x6K02T2N78B-16239704-16240654, mOR6, Olfr70, MOR262-10
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56014
Homologene: 10459
Nrxn1
Name: neurexin I
Synonyms: neurexin I alpha, 9330127H16Rik, neurexin I beta, A230068P09Rik, alpha-latrotoxin receptor (calcium-dependent), neurexin I beta, neurexin I beta, neurexin I alpha, neurexin I alpha, 1700062G21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18189
HGNC: HGNC:8008
Homologene: 21005
Ergic3
Name: ERGIC and golgi 3
Synonyms: Sdbcag84, NY-BR-84, 2310015B14Rik, CGI-54, D2Ucla1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66366
Homologene: 5289
Ankrd24
Name: ankyrin repeat domain 24
Synonyms: 4631433D01Rik, D10Bur2e, 5730519E19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70615
Homologene: 49885
Crocc
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230872
Homologene: 16811
Zbbx
Name: zinc finger, B-box domain containing
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213234
Homologene: 11661
Hbb-bh2
Name: hemoglobin beta, bh2
Synonyms: Gm5736
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 436003
Lcp1
Name: lymphocyte cytosolic protein 1
Synonyms: D14Ertd310e, Pls2, L-fimbrin, L-plastin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18826
HGNC: HGNC:6528
Homologene: 80174
Or51b17
Name: olfactory receptor family 51 subfamily B member 17
Synonyms: 5'[b]2, Olfr64, MOR1-2, GA_x6K02T2PBJ9-6648196-6649143
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18366
Homologene: 56593
Gcnt4
Name: glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)
Synonyms: C2GNT3, LOC218476, LOC238786, Gm73
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218476
VEGA: 13
Homologene: 41144
Nek2
Name: NIMA (never in mitosis gene a)-related expressed kinase 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18005
HGNC: HGNC:7745
Homologene: 74441
Lrrc63
Name: leucine rich repeat containing 63
Synonyms: 4921509B22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70859
Homologene: 52823
Or9m1
Name: olfactory receptor family 9 subfamily M member 1
Synonyms: MOR173-2, GA_x6K02T2Q125-49403456-49402524, Olfr1154
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258641
Homologene: 74192
Hacl1
Name: 2-hydroxyacyl-CoA lyase 1
Synonyms: Hpcl, Phyh2, 1600020H07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56794
Homologene: 5794
Hspa14
Name: heat shock protein 14
Synonyms: NST-1, HSP70L1, Hsp70-4, 70kDa
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50497
Homologene: 74307
Pcna
Name: proliferating cell nuclear antigen
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18538
HGNC: HGNC:8729
Homologene: 1945
Vtn
Name: vitronectin
Synonyms: Vn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22370
Homologene: 532
Cpa2
Name: carboxypeptidase A2, pancreatic
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232680
HGNC: HGNC:2297
Homologene: 37541
Insyn1
Name: inhibitory synaptic factor 1
Synonyms: 6030419C18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319477
VEGA: 9
Homologene: 18538
Or2y16
Name: olfactory receptor family 2 subfamily Y member 16
Synonyms: MOR256-28, GA_x6K02T2QP88-5991012-5990077, Olfr1388
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258459
Homologene: 74258
Ifi27l2b
Name: interferon, alpha-inducible protein 27 like 2B
Synonyms: 1810023F06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217845
Homologene: 137395
Bloc1s3
Name: biogenesis of lysosomal organelles complex-1, subunit 3
Synonyms: rp, BLOS3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232946
Homologene: 18605
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Mpk4, Pyst3
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Scgb2b11
Name: secretoglobin, family 2B, member 11
Synonyms: Abpbg11, Gm4687
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043842
Homologene: 83171
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 191,822,626 bp (GRCm38)
  • A to T, chromosome 2 at 3,489,704 bp (GRCm38)
  • A to T, chromosome 2 at 26,377,007 bp (GRCm38)
  • G to A, chromosome 2 at 28,675,749 bp (GRCm38)
  • A to G, chromosome 2 at 29,126,987 bp (GRCm38)
  • A to T, chromosome 2 at 76,943,945 bp (GRCm38)
  • A to T, chromosome 2 at 76,954,691 bp (GRCm38)
  • A to G, chromosome 2 at 87,903,082 bp (GRCm38)
  • A to G, chromosome 2 at 119,916,772 bp (GRCm38)
  • C to T, chromosome 2 at 132,252,874 bp (GRCm38)
  • A to T, chromosome 2 at 145,876,631 bp (GRCm38)
  • G to A, chromosome 2 at 152,994,103 bp (GRCm38)
  • C to A, chromosome 2 at 156,011,244 bp (GRCm38)
  • A to T, chromosome 2 at 180,036,546 bp (GRCm38)
  • T to A, chromosome 3 at 30,598,727 bp (GRCm38)
  • A to G, chromosome 3 at 75,038,052 bp (GRCm38)
  • T to C, chromosome 3 at 153,876,705 bp (GRCm38)
  • T to A, chromosome 4 at 11,513,442 bp (GRCm38)
  • G to A, chromosome 4 at 43,697,193 bp (GRCm38)
  • T to C, chromosome 4 at 141,029,245 bp (GRCm38)
  • T to C, chromosome 6 at 24,604,234 bp (GRCm38)
  • T to A, chromosome 6 at 30,545,537 bp (GRCm38)
  • T to C, chromosome 6 at 108,510,834 bp (GRCm38)
  • G to A, chromosome 7 at 19,507,483 bp (GRCm38)
  • A to G, chromosome 7 at 32,210,436 bp (GRCm38)
  • A to G, chromosome 7 at 84,305,218 bp (GRCm38)
  • A to T, chromosome 7 at 92,664,105 bp (GRCm38)
  • G to C, chromosome 7 at 101,900,329 bp (GRCm38)
  • A to G, chromosome 7 at 103,840,417 bp (GRCm38)
  • A to G, chromosome 7 at 103,893,424 bp (GRCm38)
  • A to G, chromosome 7 at 120,312,224 bp (GRCm38)
  • A to T, chromosome 7 at 144,655,621 bp (GRCm38)
  • T to C, chromosome 8 at 110,887,111 bp (GRCm38)
  • A to G, chromosome 9 at 9,059,101 bp (GRCm38)
  • A to G, chromosome 9 at 44,336,688 bp (GRCm38)
  • A to G, chromosome 9 at 58,499,598 bp (GRCm38)
  • T to C, chromosome 10 at 81,305,196 bp (GRCm38)
  • T to C, chromosome 10 at 81,646,362 bp (GRCm38)
  • T to A, chromosome 10 at 103,189,963 bp (GRCm38)
  • G to A, chromosome 11 at 20,242,142 bp (GRCm38)
  • G to A, chromosome 11 at 49,444,187 bp (GRCm38)
  • A to T, chromosome 11 at 61,159,243 bp (GRCm38)
  • A to C, chromosome 11 at 78,502,177 bp (GRCm38)
  • A to T, chromosome 11 at 95,377,483 bp (GRCm38)
  • A to T, chromosome 11 at 101,741,577 bp (GRCm38)
  • A to G, chromosome 11 at 106,335,409 bp (GRCm38)
  • A to G, chromosome 12 at 17,786,493 bp (GRCm38)
  • G to A, chromosome 12 at 24,514,819 bp (GRCm38)
  • G to T, chromosome 12 at 103,451,202 bp (GRCm38)
  • T to C, chromosome 13 at 67,517,122 bp (GRCm38)
  • T to A, chromosome 13 at 96,947,440 bp (GRCm38)
  • A to T, chromosome 13 at 112,726,057 bp (GRCm38)
  • C to A, chromosome 14 at 31,640,562 bp (GRCm38)
  • C to A, chromosome 14 at 55,075,037 bp (GRCm38)
  • T to A, chromosome 14 at 59,228,347 bp (GRCm38)
  • G to A, chromosome 14 at 75,123,060 bp (GRCm38)
  • T to C, chromosome 14 at 75,202,738 bp (GRCm38)
  • A to G, chromosome 15 at 8,228,639 bp (GRCm38)
  • A to G, chromosome 15 at 76,297,740 bp (GRCm38)
  • T to C, chromosome 16 at 14,246,749 bp (GRCm38)
  • T to A, chromosome 16 at 44,218,818 bp (GRCm38)
  • A to G, chromosome 17 at 3,685,985 bp (GRCm38)
  • C to A, chromosome 17 at 35,220,922 bp (GRCm38)
  • A to G, chromosome 17 at 90,623,614 bp (GRCm38)
  • T to A, chromosome 18 at 15,453,164 bp (GRCm38)
  • T to G, chromosome 18 at 43,241,984 bp (GRCm38)
  • T to G, chromosome 19 at 38,620,690 bp (GRCm38)
  • A to T, chromosome 19 at 60,777,960 bp (GRCm38)
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9780 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
070025-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.