Register New MMRRC Account
Reset Password
Register for New Mouse Models
Click Here for Additional Contact Information
Availability & Fees Order this Strain
Syngap1c.3583-9G>A mice have a single base substitution resulting in a cryptic splice acceptor site and premature stop codon in the Syngap1 [synaptic Ras GTPase activating protein 1 homolog (rat)] gene. Heterozygous mice display impaired synaptic plasticity, hyperactivity, and impaired working memory. This strain may be useful in studies of SRID (SYNGAP1-related intellectual disability).
Syngap1 [synaptic Ras GTPase activating protein 1 homolog (rat)] encodes a synaptic RasGAP (SynGAP) that is largely localized to dendritic spines in neocortical pyramidal neurons, where it suppresses signaling pathways linked to NMDA receptor (NMDAR)-mediated synaptic plasticity and AMPA receptor (AMPAR) membrane insertion. Syngap1 has alternative transcriptional start sites and several alternatively spliced C-terminal exons that result in many possible SynGAP isoforms. Mutations in SYNGAP1 are associated with neurodevelopmental disorders, specifically SRID (SYNGAP1-related intellectual disability). SRID is characterized by cognitive impairment, social deficits, early-onset seizures and sleep disturbances.
The Syngap1c.3583-9G>A allele has a G to A substitution at c.3583-9G that results in a cryptic splice acceptor site and premature stop codon. The c.3583-9G>A mutation was identified in a human patient.?? Mice heterozygous for the mutation have a 40-50% reduction in Syngap1 mRNA and a 50% reduction in SYNGAP1 protein. In addition, heterozygous Syngap1L813RfsX22 mice exhibit deficits in theta-burst stimulated induced long term potentiation and decreased spontaneous alternations, increased repetitive arm entries, and increased total arm entries in the Y maze. Heterozygous mice are viable and fertile, the donating investigator indicates that in homozygotes postnatal lethality occurs in 3-5 days.
To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.
The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.
Araki Y, Gerber EE, Rajkovich KE, Hong I, Johnson RC, Lee HK, Kirkwood A, Huganir RL. Mouse models of SYNGAP1 -related intellectual disability. bioRxiv [Preprint]. 2023 May 26:2023.05.25.542312. doi: 10.1101/2023.05.25.542312. (Medline PMCID: 10245951)
CRISPR/cas9 endonuclease-mediated genome editing was used to create a single base substitution at c.3583-9 (G to A) that creates a cryptic splice acceptor site and premature stop codon in intron 16 of the Syngap1 [synaptic Ras GTPase activating protein 1 homolog (rat)] on chromosome 17. The aberrant splicing results in a 7 base pair addition within mRNA transcripts. gRNA (GTACGGGGTCATGTGCCCGG), homology directed repair DNA oligos and cas9 endonuclease were introduced into C57BL/6-EZ-derived one cell stage zygotes. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6J mice for germline transmission. The mutation was confirmed by sequencing and Southern blot. Mice were backcrossed to C57BL/6J for at least three generations and then crossed with 129 mice. The colony is maintained as a cross to B6129SF1/J. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize B6129SF1/J oocytes.
Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.
Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.
A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact JHTT Communications.
A Commercial License Agreement from the Submitter is required for for-profit entities to use this strain. For more information, please contact JHTT Communications
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
We use cookies to improve your experience, personalize content, and analyze traffic. By using this site, you agree to our use of cookies. For more details, please visit our Privacy Policy.