Strain Name:
B6.129S-Syngap1em2Rlh/Mmjax
Stock Number:
071392-JAX
Citation ID:
RRID:MMRRC_071392-JAX
Other Names:
Syngap1+/c.3583-9G>A

Strain Information

Syngap1em2Rlh
Name: synaptic Ras GTPase activating protein 1 homolog (rat); endonuclease-mediated mutation 2, Richard Huganir
Synonyms: Syngap1c.3583-9GA
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: CRISPR
Syngap1
Name: synaptic Ras GTPase activating protein 1 homolog (rat)
Synonyms: Syngap
Type: Gene
Species: Mouse
Chromosome: 17
Alteration at locus: CRISPR
NCBI: 240057
Homologene: 84739
Genetic Alterations

Syngap1c.3583-9G>A mice have a single base substitution resulting in a cryptic splice acceptor site and premature stop codon in the Syngap1 [synaptic Ras GTPase activating protein 1 homolog (rat)] gene. Heterozygous mice display impaired synaptic plasticity, hyperactivity, and impaired working memory. This strain may be useful in studies of SRID (SYNGAP1-related intellectual disability).

Of note, mice with another patient-derived Syngap1 mutation (L813RfsX22) is distributed as B6;129-Syngap1em1Rlh/Mmjax, MMRRC No.71391)

Genotype Determination
ES Cell Line
C57BL/6-EZ (Applied Stem Cell - Catalog # : ASE-9007)
Phenotype

Syngap1 [synaptic Ras GTPase activating protein 1 homolog (rat)] encodes a synaptic RasGAP (SynGAP) that is largely localized to dendritic spines in neocortical pyramidal neurons, where it suppresses signaling pathways linked to NMDA receptor (NMDAR)-mediated synaptic plasticity and AMPA receptor (AMPAR) membrane insertion. Syngap1 has alternative transcriptional start sites and several alternatively spliced C-terminal exons that result in many possible SynGAP isoforms. Mutations in SYNGAP1 are associated with neurodevelopmental disorders, specifically SRID (SYNGAP1-related intellectual disability). SRID is characterized by cognitive impairment, social deficits, early-onset seizures and sleep disturbances.

The Syngap1c.3583-9G>A allele has a G to A substitution at c.3583-9G that results in a cryptic splice acceptor site and premature stop codon. The c.3583-9G>A mutation was identified in a human patient.?? Mice heterozygous for the mutation have a 40-50% reduction in Syngap1 mRNA and a 50% reduction in SYNGAP1 protein. In addition, heterozygous Syngap1L813RfsX22 mice exhibit deficits in theta-burst stimulated induced long term potentiation and decreased spontaneous alternations, increased repetitive arm entries, and increased total arm entries in the Y maze. Heterozygous mice are viable and fertile, the donating investigator indicates that in homozygotes postnatal lethality occurs in 3-5 days.

Of note, mice with another patient-derived Syngap1 mutation (L813RfsX22) is distributed as B6;129-Syngap1em1Rlh/Mmjax, MMRRC No.071391).
Strain Development

CRISPR/cas9 endonuclease-mediated genome editing was used to create a single base substitution at c.3583-9 (G to A) that creates a cryptic splice acceptor site and premature stop codon in intron 16 of the Syngap1 [synaptic Ras GTPase activating protein 1 homolog (rat)] on chromosome 17. The aberrant splicing results in a 7 base pair addition within mRNA transcripts. gRNA (GTACGGGGTCATGTGCCCGG), homology directed repair DNA oligos and cas9 endonuclease were introduced into C57BL/6-EZ-derived one cell stage zygotes. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6J mice for germline transmission. The mutation was confirmed by sequencing and Southern blot. Mice were backcrossed to C57BL/6J for at least three generations and then crossed with 129 mice. The colony is maintained as a cross to B6129SF1/J. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize B6129SF1/J oocytes.

Suggested Control Mice
Their littermates when crossed heterozygote (+/c.3583-9G>A) with C57BL6.
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
  • Models for Human Disease
  • Neurobiology
Donor
Richard Huganir, Ph.D., Johns Hopkins University.
Primary Reference

Araki Y, Gerber EE, Rajkovich KE, Hong I, Johnson RC, Lee HK, Kirkwood A, Huganir RL. Mouse models of SYNGAP1 -related intellectual disability. bioRxiv [Preprint]. 2023 May 26:2023.05.25.542312. doi: 10.1101/2023.05.25.542312. (Medline PMCID: 10245951)

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Other
Eye
Black
MMRRC Breeding System
Backcross
Generation
5
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: No No
Homozygotes are fertile: N/A N/A
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
7 to 9
Recommended wean age
3 Weeks
Average Pups Weaned
7 to 9

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact JHTT Communications.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact JHTT Communications

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
071392-JAX-SPERM Cryo-preserved spermatozoa $437.00 / $437.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
071392-JAX-RESUS Litter recovered from cryo-archive $2,022.00 / $2,022.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.