Strain Name:
C57BL/6J-Slc6a1em1Lutzy/Mmjax
Stock Number:
071548-JAX
Citation ID:
RRID:MMRRC_071548-JAX
Other Names:
C57BL/6J-Slc6a1^em1Lutzy/Mmjax

Strain Information

Slc6a1em1Lutzy
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 1; endonuclease-mediated mutation 1, Cathy LUtz
Type: Allele
Species: Mus musculus (mouse)
Chromosome:
Alteration at locus: CRISPR
Slc6a1
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 1
Synonyms: GAT-1, Gabt1, Gabt, Xtrp1, XT-1, Gat1
Type: Gene
Species: Mouse
Chromosome: 6
Alteration at locus: CRISPR
NCBI: 232333
Homologene: 2290
Genetic Alterations
The allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs were selected to insert an LSL targeting vector with a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence), upstream of exon 7 of the Slc6a1 (solute carrier family 6 (neurotransmitter transporter, GABA), member 1) gene. Slc6a1 transcript Slc6a1-201 (ENSMUST00000032454.8) was used as reference for the exon number and guide sequences. The guides (GGTGGTCAGTGGTACTTAGT and GTGGTCAGTGGTACTTAGTG) and double-stranded plasmid donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo-pregnant females.
Genotype Determination
ES Cell Line
Not applicable
Phenotype
Prior to recombination, homozygous mice are viable, born at Mendelian ratios, but are frequently non-productive in breeding. Some homozygous mice exhibit small size and ataxia.

Conditional phenotype: yes, post-cre restores expression of Slc6a1

Strain Development
Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice for germline transmission. The colony was backcrossed to C57BL/6J for at least two generations.
Suggested Control Mice
C57BL/6J
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
Donor
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Not ready to publish

Colony and Husbandry Information

For more information about this colony's health status contact csmmrrc@jax.org
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
N/A
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Reduced Reduced
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Undetermined
Recommended wean age
4 Weeks
Average Pups Weaned
Undetermined

Order Request Information

Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
071548-JAX-HET-F
071548-JAX-HET-M
071548-JAX-WT-F
071548-JAX-WT-M
Heterozygous / Hemizygous Female
Heterozygous / Hemizygous Male
Wild Type Female
Wild Type Male
$218.00 / $218.00
Non-Profit / For-Profit
Per Mouse The csmmrrc@jax.org may assess additional fees for any special requests (e.g., specific age or weight of mice, etc.).
071548-JAX-SPERM Cryo-preserved spermatozoa $437.00 / $437.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.