Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Hnrnph2em2Jpat/Mmjax
Stock Number:
071607-JAX
Citation ID:
RRID:MMRRC_071607-JAX
Other Names:
Hnrnph2 R206W KI

Strain Information

Hnrnph2em2Jpat
Name: heterogeneous nuclear ribonucleoprotein H2; endonuclease-mediated mutation 2, J Paul Taylor
Synonyms: Hnrnph2R206W, Hnrnph2em1Jpat
Type: Allele
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Knock-In
Hnrnph2
Name: heterogeneous nuclear ribonucleoprotein H2
Synonyms: Ftp3, Hnrph2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Knock-In
NCBI: 56258
HGNC: HGNC:5042
Homologene: 23165
Genetic Alterations
Hnrnph2 R206W knock-in mice carry an arginine to tryptophan amino acid substitution at codon 206 (R206W) in the X-linked Hnrnph2 (heterogeneous nuclear ribonucleoprotein H2) gene. Mice exhibit impaired motor function, increased susceptibility to audiogenic seizures and male postnatal lethality. These mice may be useful for research in Bain type of X-linked syndromic intellectual developmental disorder (MRXSB).

ES Cell Line
Not applicable
Phenotype
Mutations in the human heterogeneous nuclear ribonucleoprotein H2 (HNRNPH2) gene cause Bain type of X-linked syndromic intellectual developmental disorder (MRXSB, OMIM: 300986) with features that include developmental delay, motor function deficits, and seizures. More than 90% of patients with hnRNPH2 have a missense mutation within or adjacent to the nuclear localization signal (NLS). R206W and R206Q are the two most common missense variants. HNRNPH2 is an RNA binding protein that complexes with heterogenous nuclear RNA (hnRNA). The human and mouse genes are highly conserved differing at only 4 amino acids out of 449 amino acids.

Hnrnph2 R206W knockin mice carry CRISPR/cas9-generated, human-equivalent R206W knock-in mutation of the X-linked mouse heterogeneous nuclear ribonucleoprotein H2 (Hnrnph2) gene. This missense mutation modifies the nuclear localization signal (NLS) and impairs the interaction between HNRNPH2 and its nuclear transport receptor KapΒ2. Mice recapitulate clinical features of Bain type of X-linked syndromic intellectual developmental disorder (MRXSB), including impaired motor function and increased susceptibility to audiogenic seizures. Hemizygous males show significantly reduced postnatal survival (>60% die by 1 week of age) but are fertile if they survive until sexual maturity. Female homozygous and heterozygous mice are viable and fertile. Males, and to a lesser extent females, are smaller than wild type littermates, have craniofacial abnormalities, and an increased incidence of hydrocephalus.

Of note, the P209L mutation created by Dr. Taylor is available as C57BL/6J-Hnrnph2em1Jpat/Mmjax (MMRRC Stock No. 071606).
MeSH Terms
  • Animals
  • Humans
  • Male
  • Mice
  • Disease Models, Animal
  • Mutation
  • Mutation, Missense
  • Neurodevelopmental Disorders
  • Seizures/genetics
  • Gain of Function Mutation
  • Neurodevelopmental Disorders/genetics
  • Neurodevelopmental Disorders/therapy
  • Intellectual Disability/genetics
  • Epilepsy/genetics
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Developmental Biology
  • Models for Human Disease
  • Neurobiology
Donor
J. Paul Taylor, M.D., St. Jude Children's Research Hospital.
Primary Reference

Korff A, Yang X, O'Donovan K, Gonzalez A, Teubner BJ, Nakamura H, Messing J, Yang F, Carisey AF, Wang YD, Patni T, Sheppard H, Zakharenko SS, Chook YM, Taylor JP, Kim HJ. A murine model of hnRNPH2-related neurodevelopmental disorder reveals a mechanism for genetic compensation by Hnrnph1. J Clin Invest. 2023 Jul 17;133(14):e160309. doi: 10.1172/JCI160309. (Medline PMID: 37463454)

Kelvington BA, Abel T. hnRNPH2 gain-of-function mutations reveal therapeutic strategies and a role for RNA granules in neurodevelopmental disorders. J Clin Invest. 2023 Jul 17;133(14):e171499. doi: 10.1172/JCI171499. (Medline PMID: 37463443)

Strain Development
CRISPR/cas9 methodologies were used to insert an arginine to tryptophan amino acid substitution at codon 206 (R206W; c.833 C > T and c.835 C > G) in exon 4 of the X-linked mouse Hnrnph2 gene. Hnrnph2 transcript Hnrnph2-201 (ENSMUSG00000045427) was used as reference for the exon number and guide sequences. Single guide RNA (CCCGGCCUAUCAUAGGGACC), cas9 endonuclease and a single stranded oligonucleotide repair template were electroporated into C57BL/6J-derived zygotes. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6J mice for germline transmission. PCR and DNA sequencing confirmed the mutation. The resultant mice were backcrossed to C57BL/6J for 12 generations by the donating laboratory. Upon arrival, mice were bred to C57BL/6J for at least one generation to establish the colony.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backcross
Generation
N=12
Overall Breeding Performance
Good
NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes X-linked
Homozygotes are fertile: Yes X-linked
Hetero/Hemizygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Variable
Recommended wean age
3 Weeks
Average Pups Weaned
Variable

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Esther Allay.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Esther Allay

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
071607-JAX-RESUS Litter recovered from cryo-archive $2,123.00 / $2,123.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.