Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Cbx2em3Rek/Mmmh
Stock Number:
071609-MU
Citation ID:
RRID:MMRRC_071609-MU
Other Names:
Cbx2HA

Strain Information

Cbx2
Name: chromobox 2
Synonyms: M33
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12416
HGNC: HGNC:1552
Homologene: 7256
Genetic Alterations
HA epitope tags were inserted at the N terminus of the Cbx2 gene.
ES Cell Line
Not applicable
Phenotype
Cbx2HA mice exhibit a wild-type phenotype. The introduction of the epitope tag (2x HA) appears to not impact the function of the endogenous Cbx2 gene. Immunological detection of the CBX2 protein has been challenging due to the lack of sensitive and specific antibodies. Immunodetection of CBX2 using this epitope knock-in may allow researchers to delineate CBX2 protein expression pattern in the mouse seminiferous tubules.
The average litter size was observed to be 5.9 (median 5, stdev 2) from 17 litters when backcrossed to C57BL/6J.
MeSH Terms
  • Animals
  • Male
  • Chromatin/metabolism
  • Cell Nucleus/metabolism
  • Polycomb Repressive Complex 1/genetics
  • Polycomb Repressive Complex 1/metabolism
  • Polycomb-Group Proteins/genetics
  • Polycomb-Group Proteins/metabolism
  • Spermatogenesis/genetics
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Developmental Biology
  • Reproduction
Donor
Robert Kingston, Ph.D., Massachusetts General Hospital.
Primary Reference

Kim JJ, Steinson ER, Lau MS, de Rooij DG, Page DC, Kingston RE. Cell type-specific role of CBX2 and its disordered region in spermatogenesis. Genes Dev. 2023 Jul 1;37(13-14):640-660. doi: 10.1101/gad.350393.122. Epub 2023 Aug 8. (Medline PMID: 37553262)

Strain Development
To knock in HA epitope tags at the N terminus of the Cbx2 gene, guide RNA, single-stranded repair oligo, and Cas9 enzyme were electroporated into B6 mouse zygotes. The following 63-bp sequence was knocked in right after the ATG start codon: TATCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCC (inserted right after position chr11:119023111, mm10). One Gly linker (underlined) was placed between HA sequences, and one GlySer linker (underlined) was placed between the 2xHA and CBX2 proteins (YPYDVPDYAGYPYDVPDYAGS). Three mice (two HA/deletion males and one HA/HA female) contained the correctly targeted allele. Two founder males sired progenies. Targeted strains were backcrossed at least 10 times to C57BL/6J mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backcross
Generation
10
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Undetermined Undetermined
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size

The donating researcher reports that the observed average litter size was 5.9 (median 5, stdev 2) from 17 litters when backcrossed to C57BL/6J.

Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
071609-MU-SPERM Cryo-preserved spermatozoa $437.00 / Non-Profit Aliquot Approximate quantity3
071609-MU-RESUS Litter recovered from cryo-archive $2,624.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.