Strain Name:
conditional IL2 KO
Stock Number:
071627-MU
Citation ID:
RRID:MMRRC_071627-MU
Other Names:
conditional IL2 KO

Strain Information

Il2tm1.1Kasm
Name: interleukin 2; targeted mutation 1.1, Kendall A Smith
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Conditional
Il2
Name: interleukin 2
Synonyms: IL-2
Type: Gene
Species: Mouse
Chromosome: 3
Alteration at locus: Conditional
NCBI: 16183
HGNC: HGNC:6001
Homologene: 488
Genetic Alterations
Tamoxifen-induclible CRE-LOX deletion of exons 1 and 2 of IL2.
ES Cell Line
C57Bl/6J-693 derived from C57BL/6J
Phenotype
None/Normal/Wild-type

Conditional phenotype: No

Strain Development
From the published paper: https://www.frontiersin.org/articles/10.3389/fimmu.2012.00102/full To circumvent the IL-2 deficiency T cell hyperproliferative/autoimmune syndrome that occurs when the il2 gene is deleted conventionally, an il2 conditional (−/−) was constructed by inGenious Targeting Laboratory, Inc., Stony Brooke, NY, as shown in Figure 1A. The 62-bp lox P cassette was placed on 1402 bp of the il2 gene including exons I and II. The Neo cassette (3′–5′ orientation) was placed between exons II and III. The primers LAN1 and UNI are indicated, and FRT and loxP sites are also indicated. The reverse primer A3 was used for ES cell screening and F1 genotyping with the LAN1 Neo primer, while the primer LOX1 was used for sequence verification of the single lox P site in PCR applicants from ES clones using DL1 and the Neo primer UNI. F1 genotyping of the single Lox P site by PCR was performed using DL1 and LOX1 primers, and the PCR products were sequenced by LOX1. To remove the Neo cassette, targeted C57BL/6 ES cells were microinjected into Balb/c blastocysts. Resulting chimeras with a high percentage of black coat color were mated to wild type (WT) C57BL/6 mice to generate F1 heterozygous offspring. F1 heterozygotes were mated with FLP heterozygotes (Step 2), which were screened for Neo deletion and the FLP transgene. Neo deleted heterozygotes were mated with WT mice and screened for Neo deletion and FLP transgene deletion. Homozygous Neo deleted mice were then mated with Cre-ERT2 mice (Ruzankina et al., 2007). Cre-ERT2 mice contain a gene encoding a fusion protein composed of Cre recombinase and a mutant form of the estrogen receptor that is selectively activated only in the presence of tamoxifen (TAM), but not estrogen. In combination with a flox-conditional allele of il2, the Cre-ERT2 line (hereafter referred to as Cre+) provides a system to efficiently delete the il2 gene both spatially and temporally in the mouse (Ruzankina et al., 2007). The 62bp lox P cassette: (CGCGGTGGTACCATAACTTCGTATAGCATACATTATACGAAGTTATGAATTCGTCGCCACCG), flanked by EcoRI and KpnI sites; FRT(GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC), and loxP (ATAACTTCGTATAATGTATGCTATACGAAGTTAT) sites are indicated in Figure 1A. FLP heterozygotes (Jackson Lab #0033800) and Cre-ERT2 (Ruzankina et al., 2007) were used.
Suggested Control Mice
WT (C57BL/6; Jackson Lab #000664) and conventional IL-2(−/−) mice (Jackson Lab #002252)
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
  • Immunology and Inflammation
  • Virology
Donor
Kendall Smith, M.D., Cornell University Weill Cornell Medical College.
Primary Reference

Popmihajlov Z, Xu D, Morgan H, Milligan Z, Smith KA. Conditional IL-2 Gene Deletion: Consequences for T Cell Proliferation. Front Immunol. 2012 May 10;3:102. doi: 10.3389/fimmu.2012.00102. (Medline PMCID: 3349275)

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
made on C57Bl/6 background so not relevant
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Bred to Homozygosity
No
Average litter size
Undetermined
Recommended wean age
3 Weeks
Average Pups Weaned
Undetermined

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact CTL Contracts Officer.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact CTL Contracts Officer

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
071627-MU-RESUS Litter recovered from cryo-archive $2,624.00 / $5,340.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.