The Slc13a5em1(SLC13A5)Lutzy allele was generated using CRISPR/cas9 endonuclease-mediated genome editing. Guide RNAs (CGCCGAATCCATCGCGTGAA, GCCGAATCCATCGCGTGAAA, TGCGTGTCTGGGCAGCCTGG, AGTTGCGTGTCTGGGCAGCC) were selected to excise and replace coding murine exon 1 of the Slc13a5 (solute carrier family 13 (sodium-dependent citrate transporter), member 5) gene on chromosome 11 with a full-length 568 amino acid WT human SLC13A5 cDNA with bGH poly(A) transcription termination signal. The insertion prevents translation of the mouse Slc13a5 cDNA. The guides and ds plasmid donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females. Slc13a5 transcript Slc13a5-201 (ENSMUST00000021161.14) was used as reference for the exon number and guide sequences. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice for germline transmission. The colony was backcrossed to C57BL/6J for at least two generations.
Viability and Fertility: | Female | Male | Comments |
---|---|---|---|
Homozygotes are viable: | Yes | Yes | |
Homozygotes are fertile: | Yes | Yes | |
Heterozygotes are fertile: | Yes | Yes | |
Age Reproductive Decline: | Undetermined | Undetermined |
Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
MMRRC Item # | Description | Distribution Fee / Unit (US $) *Shipping & Handling not included* |
Units | Notes |
---|---|---|---|---|
071645-JAX-HOM-F 071645-JAX-HOM-M |
Homozygous Female Homozygous Male |
$229.00 / $229.00 Non-Profit / For-Profit |
Per Mouse | The csmmrrc@jax.org may assess additional fees for any special requests (e.g., specific age or weight of mice, etc.). |
071645-JAX-SPERM | Cryo-preserved spermatozoa | $459.00 / $459.00 Non-Profit / For-Profit |
Aliquot | Approximate quantity3 |
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information. |
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
Text