Strain Detail Sheet

Strain Name:
Npm-D180
Stock Number:
071648-UCD
Citation ID:
RRID:MMRRC_071648-UCD
Other Names:
Npm-D180

Strain Information

Gene Details

Npm1
Name: nucleophosmin 1
Synonyms: nucleolar protein NO38, B23, NO38
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18148
HGNC: HGNC:7910
Homologene: 81697
Genome Browser [Click image to go to Jbrowse]



Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Genetic Alterations
Easi-CRISPR generated knock-in of single amino acid deletion (aspartic acid 180 [D180]) identified in a patient with dyskeratosis congenitia.
ES Cell Line
Not applicable

Strain Description

Phenotype
Mice show no overt phenotypes, but examination of the bone marrow indicates some features associated with bone marrow failure.
Strain Development
Mice were generated as described in Quadros et al. (2017). Injections to C57BL/6 zygotes were performed at the Beth Israel Deaconess Transgenic Core Facility. The single stranded oligodeoxynucleotide for homologous recombination was purchased from IDT. For genotyping, a DraI restriction site was inserted into the single-stranded oligo-deoxynucleotide by mutating the sequence TTCAAA to TTTAAA. Cas9 for injection, as well as the single guide RNAs, were purchased from PNA BIO. Chimeric mice were crossed to C57BL/6J mice to confirm germline transmission of the NPM1-D180del allele, and subsequent progeny were backcrossed to C57BL/6J mice to maintain the pure background.Oligos for generation of NPMD180del mice:sgRNA1 TTAGTGCTAGTAGTAAAAAC sgRNA2 ACTTGAGAGTATTGTTTCAA ssODN AAAAAGCCTAGTTTCTTTATGGTTTGGTACAAAGCTGATTTGGTTGAAGCTATTTATTTACTAATAACATTGCAAAATTAATCAACTACACAACTTTGAAACAATACTCTCAAGTATTATATAAAAATGTTTGTTAGGTTTCTTAAGTATTGATCCATTTAAATACTGGTGCAAATTCACTTTTATTAACAATTGTGCTACAGTGGATGAATATGGTTTAGTTCTTTTGTAAAATTGACTAAAAATTTAAGTTCTGTGTGTTGGCTTATTTCATTTATAGTGATGATGATGATTTTGATGAAGAGGAAACTGAAGAAAAGGTCCCAGTGAAGAAAGTGAGTACATGAGATACTATGAGGTTTATCATGGGTAGCTAGTAAAAGGATGGGAATTTCTTAGTGCTAGTAGTAAAAACTCTGAATTGATCTTAAAAATTGGTTCTGAGCTAAACAGGAAAATTTGAGAACGCTATCTGTATGTGAGTTACAATTTATTAGTTTGTTTTA [Quadros, R. M. et al. Easi-CRISPR: a robust method for one-step generation of mice carrying conditional and insertion alleles using long ssDNA donors and CRISPR ribonucleoproteins. Genome Biol. 18, 92 (2017).]
Suggested Control Mice
C57BL/6J mice are considered controls.

MMRRC Genetic QC

MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@ucdavis.edu. Older strains may not have this information.

Research Applications

  • Cancer
  • Developmental Biology
  • Hematology
  • Models for Human Disease

Strain Origin

Donor
Pier Paolo Pandolfi, M.D., Renown Health.
John (Sean) Clohessy, Ph.D., Beth Israel Deaconess Medical Center, Inc..
Primary Reference

Nachmani D, Bothmer AH, Grisendi S, Mele A, Bothmer D, Lee JD, Monteleone E, Cheng K, Zhang Y, Bester AC, Guzzetti A, Mitchell CA, Mendez LM, Pozdnyakova O, Sportoletti P, Martelli MP, Vulliamy TJ, Safra M, Schwartz S, Luzzatto L, Bluteau O, Soulier J, Darnell RB, Falini B, Dokal I, Ito K, Clohessy JG, Pandolfi PP. Germline NPM1 mutations lead to altered rRNA 2'-O-methylation and cause dyskeratosis congenita. Nat Genet. 2019 Oct;51(10):1518-1529. doi: 10.1038/s41588-019-0502-z. Epub 2019 Sep 30. (Medline PMCID: 6858547)

Colony and Husbandry Information

Special Considerations

N/A

Health Status Report

Colony Surveillance Program and Current Health Reports

For more information about this colony's health status contact mmrrc@ucdavis.edu

Appearance

Coat Color
Black
Eye
Black

Breeding

MMRRC Breeding System
Backcross
Generation
N > 9
Overall Breeding Performance
Good

Reproductive Statistics

Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: 10 to 12 months 10 to 12 months
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Request Information

Availability Level

The availability level for this product has not been determined.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact TVO Director.

Conditions of Distribution

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact TVO Director

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Fees

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.
To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.