Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Txnrd1em1Lgr/Mmjax
Stock Number:
071822-JAX
Citation ID:
RRID:MMRRC_071822-JAX
Other Names:
C57BL/6J-Txnrd1em1Lgr/Lgr

Strain Information

Txnrd1em1Lgr
Name: thioredoxin reductase 1; endonuclease-mediated mutation 1, Laura G Reinholdt
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: CRISPR
Txnrd1
Name: thioredoxin reductase 1
Synonyms: TrxR1, TR1, TR alpha, TR
Type: Gene
Species: Mouse
Chromosome: 10
Alteration at locus: CRISPR
NCBI: 50493
VEGA: 10
Homologene: 55733
Genetic Alterations
Txnrd1-deficient mice carry a 220bp deletion containing the 75bp SECIS translational regulatory element, along with the flanking 3'UTR, of the thioredoxin reductase 1 (Txnrd1) gene. These mice may be useful when studying the role of Txnrd1 in redox homeostasis.
Genotype Determination
ES Cell Line
Not applicable

Phenotype
Thioredoxin reductases (TXNRDs) are selenocysteine-containing flavoenzymes, which reduce thioredoxins, as well as other substrates. TXNRDs play a role in cellular redox signaling and oxidative stress response pathways as well as cell proliferation. In mammals, there are three isoforms of TXNRDs, namely the cytosolic TXNRD1, mitochondrial TXNRD2 and testis-specific TXNRD3. These Txnrd1-deficient mice carry a 220bp deletion containing the 75bp SECIS translational regulatory element, along with the flanking 3'UTR, of the thioredoxin reductase 1 (Txnrd1) gene. Heterozygous mice are viable and fertile; homozygous mice are embryonic lethal. The donating laboratory notes that primary fibroblasts generated from heterozygous mice exhibit increased sensitivity to arsenic. These mice may be useful for studying the role of Txnrd1 in redox homeostasis.

Conditional phenotype: No

MeSH Terms
  • Quantitative Trait Loci
  • Animals
  • Mice
  • Arsenic/toxicity
  • Oxidative Stress/genetics
  • Oxidative Stress/drug effects
  • Humans
  • Fibroblasts/metabolism
  • Fibroblasts/drug effects
  • Cell Line
  • NF-E2-Related Factor 2/genetics
  • NF-E2-Related Factor 2/metabolism
  • Gene-Environment Interaction
  • Arsenic Poisoning/genetics
  • Chromosome Mapping
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Apoptosis
  • Cell Biology
Donor
Laura Reinholdt, The Jackson Laboratory.
Primary Reference

O'Connor C, Keele GR, Martin W, Stodola T, Gatti D, Hoffman BR, Korstanje R, Churchill GA, Reinholdt LG. Unraveling the genetics of arsenic toxicity with cellular morphology QTL. PLoS Genet. 2024 Apr 25;20(4):e1011248. doi: 10.1371/journal.pgen.1011248. (Medline PMID: 38662777)

Strain Development
The Txnrd1-deficient allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. Two sets of guide RNAs (gRNAs) were used (gRNA up 1:GGAGGCTGCAGCATCGCACT, gRNA down 1: GGGTTAATGATACTAGAGAT, gRNA up 2: GAGGCTGCAGCATCGCACTG, gRNA down 2: GGTTAATGATACTAGAGATA) to delete a 200-bp region containing the 75-bp SECIS translational regulatory element, as well as the flanking 3' UTR, of the thioredoxin reductase 1 (Txnr1) gene on chromosome 10. The gRNAs and the Cas9 nuclease mRNA were introduced into the cytoplasm of C57BL/6J zygotes with well recognized pronuclei. Off-target effects were assessed using the Benchling algorithm (https://benchling.org) and for all gRNAs, potential off-target sites were scored <2.0. Two F0 founders (male 5007 and female 5016) carrying the expected 220-bp deletion at chr10:82,896,230–82,896,450 (GRCm38) were identified by PCR. Male founder 5007 was backcrossed to C57BL/6J females to establish N1 progeny. The donating laboratory backcrossed the N1 progeny to C57BL/6J for an additional 4 generations. Sperm was cryopreserved at The Jackson Laboratory. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
N3
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: No No
Homozygotes are fertile: N/A N/A
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
071822-JAX-SPERM Cryo-preserved spermatozoa $459.00 / $459.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
071822-JAX-RESUS Litter recovered from cryo-archive $2,123.00 / $2,123.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.