Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Kcnq2em4Lutzy/Mmjax
Stock Number:
071896-JAX
Citation ID:
RRID:MMRRC_071896-JAX
Other Names:
C57BL/6J-Kcnq2em4Lutzy/Mmjax

Strain Information

Genetic Alterations
Kcnq2G256W knock-in mice carry a CRISPR/Cas9-generated G256W amino acid substitution in the Kcnq2 (potassium voltage-gated channel, subfamily Q, member 2) gene.
ES Cell Line
CRISPR
Phenotype
Kcnq2G256W knock-in mice carry a CRISPR/Cas9-generated G256W amino acid substitution in the Kcnq2 (potassium voltage-gated channel, subfamily Q, member 2) gene. This strain may be useful for studying KCNQ2 encephalopathy. Heterozygous Kcnq2G256W KI mice are viable and fertile; however, infrequent epileptic seizures may be present. Homozygous mice are perinatal lethal. These mice may be useful for studying KCNQ2 encephalopathy.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
In preparation, submitted, or in press
Strain Development
The Kcnq2^G256W knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (CTGGTGTACTTGGCAGAAAA and TCTGGTGTACTTGGCAGAAA) and a single stranded oligo donor, carrying two nucleotide differences (bolded and capitalized below) to change the glycine GGT codon to a tryptophan TGG codon (G256W), were used to target the potassium voltage-gated channel, subfamily Q, member 2 (Kcnq2) gene on chromosome 2. Guide RNAs, cas9, and the oligo donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females. DNA sequencing of the targeted region identified a single founder female that carried the desired G256W mutation in trans to a frameshifting indel E254fs*16 mutation (deletion of the AAAGGG nucleotides overlapping with the PAM sequence). The two alleles were separated and two distinct lines [Kcnq2^G256W and Kcnq2^E254fs*16] were established by backcrossing to C57BL/6J for at least 3 generations.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
N>3 generations to C57BL/6J
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: No No
Homozygotes are fertile: N/A N/A
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Undetermined
Recommended wean age
3 Weeks
Average Pups Weaned
Undetermined

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.