Loading...

Strain Detail Sheet

Strain Name:
C57BL/6J-Mafbem1Lutzy/Mmjax
Stock Number:
072070-JAX
Citation ID:
RRID:MMRRC_072070-JAX
Other Names:
C57BL/6J-Mafb^em1Lutzy/Mmjax

Strain Information

Gene Details

Mafb
Name: MAF bZIP transcription factor B
Synonyms: Kreisler, Krml1, Krml
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16658
HGNC: HGNC:6408
Homologene: 31315

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Genetic Alterations
MafbP71R knock-in (KI) mice harbor a CRISPR/Cas9-generated human P71R missense variant in exon 1 of the MAF bZIP transcription factor B (Mafb) gene.
Genotype Determination
ES Cell Line
Not applicable

Strain Description

Phenotype
Heterozygous mice are viable and fertile but are smaller in body size compared to wildtype littermates. Homozygous mice are embryonic/perinatal lethal. Cortical and trabecular bone volume is decreased in heterozygous mice and have progressive nephropathy, starting at 11 weeks of age, resulting in kidney failure. The donating laboratory confirmed that expression of the humanized Mafb variant in kidney tissue was not significantly different from endogenous wildtype expression in heterozygous MafbP71R KI animals.
Strain Development
The MafbP71R knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (TGGCCGCGGAGCTGAGCATG and GCGACGGCTGCGGGCGGCAA) were selected to excise and replace murine amino acids 5-202 in exon 1 of the MAF bZIP transcription factor B ()Mafb) gene, on chromosome 2, with human amino acids 5-202 of MAFB (MAFB-201; ENST00000373313.3) exon 1 with the P71R (CCC to CGC) missense variant. Mouse Mafb-201 transcript (ENSMUST00000099126.5) was used as reference for the exon number and guide sequences. Guide RNA, cas9, and the double-stranded plasmid donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females.
Suggested Control Mice
WT littermates, C57BL/6J inbred and/or MMRRC ID 72071

MMRRC Genetic QC

MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.

Research Applications

  • Developmental Biology
  • Hematology
  • Internal/Organ

Strain Origin

Donor
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Not ready to publish

Colony and Husbandry Information

Special Considerations

HET x WT or HET x C57BL/6J matings (or recip)

Health Status Report

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.

Appearance

Coat Color
Black
Eye
Black

Breeding

MMRRC Breeding System
Backcross
Generation
N>2
Overall Breeding Performance
Good

Reproductive Statistics

Viability and Fertility: Female Male Comments
Homozygotes are viable: No No
Homozygotes are fertile: N/A N/A
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: 4 to 6 months 4 to 6 months
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Request Information

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Conditions of Distribution

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*		 Units Notes
072070-JAX-SPERM Cryo-preserved spermatozoa $459.00 / $459.00
Non-Profit / For-Profit		 Aliquot Approximate quantity3
072070-JAX-RESUS Litter recovered from cryo-archive $2,123.00 / $2,123.00
Non-Profit / For-Profit		 Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.