Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Puraem2Lutzy/Mmjax
Stock Number:
072139-JAX
Citation ID:
RRID:MMRRC_072139-JAX
Other Names:
C57BL/6J-Pura^em2Lutzy/Mmjax

Strain Information

Pura
Name: purine rich element binding protein A
Synonyms: ssCRE-BP, CAGER-1, Pur-alpha, Pur alpha
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19290
HGNC: HGNC:9701
Homologene: 4279
Genetic Alterations
PuraKO mice have exon 2 deleted in the Pura gene.
ES Cell Line
Not applicable
Phenotype
PuraKO mice have endogenous exon 2 deleted in the purine-rich element binding protein A (Pura) gene, resulting in a null allele. PUR-α has regulatory roles in DNA replication, gene transcription, RNA transport, and mRNA translation as well as early brain development and neuronal function. Pura mutations are implicated in a rare genetic disease, PURA syndrome, which represents multiple symptoms such as hypotonia, apnea, seizures and congenital heart defects. Heterozygous and homozygous mice are viable. Homozygous mice demonstrate a severe neurological phenotype and do not survive beyond 3-5 weeks of age. Heterozygous mice are fertile but display a lethal seizure phenotype and only survive to 5-15 weeks of age. If additional characterization of these mice is performed, we may modify the strain description accordingly.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Not ready to publish
Strain Development
The PuraKO allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing and was a byproduct when trying to create the PuracKO allele (RRID:MMRRC 072138-JAX). Guide RNAs (TGCGCCCGCCCGACTGTGCG, GAAGAGAAACTGTCAGTTGG) were selected to excise murine exon 2 of the purine rich element binding protein A (Pura) gene on chromosome 18, without replacement. Mouse Pura-201 transcript (ENSMUST00000051301.6) was used as reference for the exon number and guide sequences. Guide RNA, cas9, and the double stranded plasmid donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice for germline transmission. The colony was backcrossed to C57BL/6J for at least two generations.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

HET mice are fertile but do display a seizure phenotype and only survive up to 5-15 weeks of age.

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backcross
Generation
N>2
Overall Breeding Performance
Poor
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: No No
Heterozygotes are fertile: Reduced Reduced
Age Reproductive Decline: Less than 4 months Less than 4 months
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
072139-JAX-SPERM Cryo-preserved spermatozoa $473.00 / $473.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
072139-JAX-RESUS Litter recovered from cryo-archive $2,187.00 / $2,187.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.