Loading Mouse GIF
Loading...

Strain Name:
STOCK Prop1em2Sac/Mmjax
Stock Number:
075663-JAX
Citation ID:
RRID:MMRRC_075663-JAX
Other Names:
Prop1flox

Strain Information

Prop1
Name: paired like homeodomain factor 1
Synonyms: prophet of Pit1, prophet of Pit-1, Prop-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19127
HGNC: HGNC:9455
Homologene: 4558
Genetic Alterations
Prop1flox have loxP sites flanking exon2 of the Prop1 gene. These mice may be useful for generating conditional mutants when studying pituitary development and hormone production.
ES Cell Line
Not applicable
Phenotype

Prop1 (paired like homeodomain factor 1) encodes a transcription factor required for pituitary cell differentiation and production of growth hormone (GH), prolactin, and thyroid stimulating hormone (TSH). These Prop1flox mice possess loxP sites flanking exon 2 of the Prop1 gene.

Homozygous mice are viable and fertile with no overt phenotype. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have exon 2 deleted in the cre-expressing tissues, resulting in complete loss of PROP1 protein. The donating laboratory bred homozygous Prop1flox mice to Hesx1cre/+; Prop1tm1Sac/+ mice, and found resulting Prop1flox/tm1Sac; Hesx1cre/+ progeny demonstrated phenotypes similar to the Prop1df allele, including stunted growth and absence of GH, prolactin and TSH.

These Prop1flox may be useful for studying pituitary development and hormone production.

Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Developmental Biology
  • Endocrine Deficiency
Submitter
Sally A. Camper, Ph.D., University of Michigan.
Primary Reference
In preparation, submitted, or in press
Strain Development
The Prop1flox allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A guide RNA (AGGATACTGGTTCCTCCCAA (AGG) REV) was used to introduce loxP sites 100bp upstream and downstream of exon 2 of the paired like homeodomain factor 1 (Prop1) gene on chromosome 11. Cas9 nuclease, sgRNA and double-stranded donor plasmid were introduced into the cytoplasm of zygotes derived from (C57BL/6 x SJL/J) F1 x F1 mice mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. A single founder was identified with the 5' loxP site intact. This founder was crossed to C57BL/6 mice additional animals, and those carriers were intercrossed to generate homozygous Prop1flox/flox male mice. Homozygous mice were then crossed to C57BL/6J mice to generate fertilized eggs for microinjection of CRISPR/Cas9 reagents to introduce the 3' loxP site. A new guide RNA (AAGCTGCCATTTCCGACTCC (AGG) FOR) was designed, and a single stranded oligonucleotide template oligonucleotide donor sequence was used, to introduce a loxP site 229bp upstream of exon 3 of the Prop1 gene. Resulting progeny, with confirmed 5' loxP and 3' loxP sites intact, were backcrossed to C57BL/6J mice for 4 generations by the donating laboratory to reduce off-target events. Subsequently, homozygous Prop1flox/flox mice were mated to (C57BL/6J x 129/SvJ)F1 to generate heterozygous mice to be used as donors. Upon arrival, sperm was cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
C57BL/6 mix, not backcrossed.
Overall Breeding Performance
Excellent
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
075663-JAX-SPERM Cryo-preserved spermatozoa $473.00 / Non-Profit Aliquot Approximate quantity3
075663-JAX-RESUS Litter recovered from cryo-archive $2,187.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.