Loading Mouse GIF
Loading...

Strain Name:
C57BL/6NCrl-Slc22a7
Stock Number:
075702-UCD
Citation ID:
RRID:MMRRC_075702-UCD
Other Names:
AFDN
Major Collection:

Strain Information

Slc22a7em1(IMPC)Tcp
Name: solute carrier family 22 (organic anion transporter), member 7; endonuclease-mediated mutation 1, The Centre for Phenogenomics
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: CRISPR
Slc22a7
Name: solute carrier family 22 (organic anion transporter), member 7
Synonyms: OAT2, NLT
Type: Gene
Species: Mouse
Chromosome: 17
Alteration at locus: CRISPR
NCBI: 108114
VEGA: 17
Homologene: 21328
Genetic Alterations
This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGACTCCCCCAGACCTCCGT targeting the 5' side and CAGGCGCCCAGGCGCTCCAA targeting the 3' side of a critical region (ENSMUSE00000542695). This resulted in a 368-bp del chr17:46745722 to 46746089 and a 6-bp deletion (GGAGGT) chr17:46746115 to 46746120_insTC on the minus strand (GRCm39).
Phenotype
Phenotyping data may be available at mousephenotype.org.
Strain Development
Cas9 components were microinjected or electroporated into C57BL/6NCrl zygotes and progeny were screened for the desired mutation. Founders were mated to C57BL/6NCrl mice, and derived N1 progeny were identified by PCR and/or sequencing and subjected to quality control including allele sequencing. N1 mice passing QC were then backcrossed to C57BL/6NCrl mice to generate N2 mice identified by PCR. Mutant mice backcrossed at least 2 generations (N2 or more) were intercrossed to produce cohorts for phenotyping. Backcrossed (N2 or more) or intercrossed (N2F1 or more) heterozygous mice were used for cryopreservation.
Suggested Control Mice
wild-type from colony
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@ucdavis.edu. Older strains may not have this information.
Donor
Lauryl Nutter, Ph.D., The Toronto Centre for Phenogenomics.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@ucdavis.edu.

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.