Loading Mouse GIF
Loading...

Strain Name:
129S4;B6-G6pc1em1Jyc/Mmucd
Stock Number:
075777-UCD
Citation ID:
RRID:MMRRC_075777-UCD
Other Names:
G6pc-R83C mouse

Strain Information

G6pc1em1Jyc
Name: glucose-6-phosphatase catalytic subunit 1; endonuclease-mediated mutation 1, Janice Yang Chou
Synonyms: G6pc-R83C
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: CRISPR
G6pc1
Name: glucose-6-phosphatase catalytic subunit 1
Synonyms: G6Pase, G6pt, Glc-6-Pase, Glc-6-Pase-alpha, G6pc
Type: Gene
Species: Mouse
Chromosome: 11
Alteration at locus: CRISPR
NCBI: 14377
HGNC: HGNC:4056
Homologene: 20079
Genetic Alterations
Arginine codon 83 (CGC) in exon 2 was changed to cysteine (TGC) (p.R83C) using an sgRNA (targeting GTTTGGACAACGCCCGTATTG) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics the same human mutation found in glycogen storage disease type Ia (GSD-Ia) patients.
Phenotype
G6pc-R83C mice exhibit impaired glucose homeostasis and frequent hypoglycemic seizures, mimicking the pathophysiology of Glycogen storage disease type Ia (GSD-Ia) patients. The G6pc-R83C mice also display hypoglycemia, hypertriglyceridemia, hypercholesterolemia, and hyperuricemia.
MeSH Terms
  • Animals
  • CRISPR-Cas Systems/genetics
  • Dependovirus/genetics
  • Disease Models, Animal
  • Gene Editing
  • Genetic Therapy
  • Genetic Vectors/genetics
  • Glucose/genetics
  • Glucose/metabolism
  • Glucose-6-Phosphatase/genetics
  • Glycogen Storage Disease Type I/genetics
  • Glycogen Storage Disease Type I/metabolism
  • Glycogen Storage Disease Type I/pathology
  • Glycogen Storage Disease Type I/therapy
  • Humans
  • Liver/metabolism
  • Liver/pathology
  • Mice
Strain Development
The heterozygous G6pc-R83/R83C mice in the C57BL/6 background were generated by microinjecting Cas9 mRNA, lead gRNA, and a donor template of 2 kb that substitutes CGC (R) with TGC (C) at codon 83 in exon 2 of the mouse G6pc gene into the C57BL/6 embryos. The resulting animals were screened by Sanger sequencing of topoisomerase (TOPO)-cloned PCR products to identify mice harboring the mutant allele. The G6pc-R83/R83C mice carrying one R83 (wild type) and one R83C allele in the C57BL/6 background were used to start the breeding colony. As expected, homozygous G6pc-R83C mice in the C57BL/6 background died within 24h after birth. Therefore wild-type heterozygous G6pc-R83/R83C and homozygous G6pc-R83C mice in the mixed C57BL/129 background were generated, which were designated as G6pc-R83, G6pc-R83/R83C, and G6pc-R83C mice, respectively.
Suggested Control Mice
Sex-matched littermates wild type (G6pc-R83) and heterozygote (G6pc-R83/R83C) mice were used as the control mice.
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@ucdavis.edu. Older strains may not have this information.
  • Metabolism
  • Models for Human Disease
Donor
Janice Chou, Ph.D., NICHD/NIH.
Primary Reference

Arnaoutova I, Zhang L, Chen HD, Mansfield BC, Chou JY. Correction of metabolic abnormalities in a mouse model of glycogen storage disease type Ia by CRISPR/Cas9-based gene editing. Mol Ther. 2021 Apr 7;29(4):1602-1610. doi: 10.1016/j.ymthe.2020.12.027. Epub 2020 Dec 23. (Medline PMID: 33359667)

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@ucdavis.edu.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
N/A
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: Reduced Reduced
Homozygotes are fertile: Undetermined Undetermined
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: 7 to 9 months 7 to 9 months
Average litter size
7 to 9
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
075777-UCD-RESUS Litter recovered from cryo-archive $4,044.00 / $7,650.23
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.