Loading Mouse GIF
Loading...

Strain Name:
B6N.B6J-Rgs14em1Jorh/Mmnc
Stock Number:
075790-UNC
Citation ID:
RRID:MMRRC_075790-UNC
Other Names:
RGS14(L507R)

Strain Information

QUALITY CONTROL OF B6N.B6J-Rgs14em1Jorh/Mmnc  |  University of North Carolina at Chapel Hill
Last Updated:
Strain Data and Information Information by Submitter Assessed by MMRRC1,2
Published Provided
Allele-specific genotype3  YES
Genetic background  n.d.
Viability of genotypes available for distribution  n.d.
Specific Pathogen- Status  YES
Recoverability of cryopreserved sperm/embryos4  YES
Gene or allele sequence3  n.d.
Gene or allele expression3  n.d.
Gene or allele function3  n.d.
Observable and/or measurable phenotypes  n.d.
Fertility of genotypes available for distribution  n.d.
Fecundity/breeding performance  n.d.

1 When indicated as verified ("YES"), then please note that information presented is to the best of our knowledge correct and up-to-date at the time of verification at the MMRRC Distribution Center; however, this information is subject to change due to breeding, maintenance, and other actions on the mouse strain at the MMRRC Distribution Center; direct any questions on this table to the MMRRC Distribution Center for this mouse stain.

2 If verification has not been performed (as indicated by "NO"), investigators may request specific verification testing for a fee. Requests should be submitted directly to the MMRRC Distribution Center assigned to the management, archiving, and distribution of the strain. A full listing of available testing and analytical services is available at https://www.mmrrc.org/about/services.php.

3 This information may or may not apply to each individual engineered allele (e.g., Cre, FlpO) present in the strain.

4 Recovery refers to thawing, in vitro fertilization (IVF), and/or embryo culture leading to live offspring.

Rgs14em1Jorh
Name: regulator of G-protein signaling 14; endonuclease-mediated mutation 1, John R Hepler
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: CRISPR
Rgs14
Name: regulator of G-protein signaling 14
Synonyms: Rap1/rap2 interacting protein
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 51791
HGNC: HGNC:9996
Homologene: 4735
Genetic Alterations
Leucine codon 507 (CTG) in exon 15 was changed to arginine (CGG) (p.L507R) using an sgRNA (targeting CTGGTGGAGCTGCTGAATCGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.L505R variant in the nuclear export sequence (NES) of the encoded peptide, which blocks export of the protein from the nucleus.
Genotype Determination
  • Genotyping Protocol(s)
  • Center protocol and contact for technical support will be shipped with mice.
  • ES Cell Line
    Not applicable
    Phenotype

    These mice express a substitution mutation in the RGS14 gene that coverts amino acid Leu507 to Arg507 (L507R), reflecting a reported human mutation (L505R) in the human RGS14 gene (PMID:33410399). The (L507R) mutation is within the nuclear export sequence (NES) of RGS14 and has the effect of blocking nuclear export. RGS14 is constitutively trapped within the nuclei of hippocampal (and other) neurons in brain. Wild-type RGS14 is able to block long-term potentiation (LTP) in hippocampal neurons while RGS14(L507R) is unable to block LTP. The mice behave and appear normal, but have not been tested for behavioral or physiological phenotypes and likely have notable deficits if challenged with different tests.

    Outside of brain, RGS14 is expressed in heart, liver, kidney, lymphocytes, adipose tissue and elsewhere. Effects of this mutation on those systems has not been tested.

    MeSH Terms
    • Animals
    • RGS Proteins/metabolism
    • RGS Proteins/genetics
    • Mice
    • Male
    • Brain/metabolism
    • Mice, Inbred C57BL
    • Neurons/metabolism
    Strain GQC Summary
    Gene Specific Genotyping:

    To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

    Background Genetic Quality:

    The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

    Suggested Control Mice
    Littermates of all relevant genotypes.
    • Cell Biology
    • Immunology and Inflammation
    • Neurobiology
    • Research Tools
    Submitter
    John Hepler, Ph.D., Emory University School of Medicine.
    Primary Reference

    Bramlett SN, Fitzmaurice SM, Harbin NH, Yan W, Bandlamudi C, Van Doorn GE, Smith Y, Hepler JR. Regulator of G protein signalling 14 (RGS14) protein expression profile in the adult mouse brain. Eur J Neurosci. 2024 Dec;60(12):7058-7085. doi: 10.1111/ejn.16592. Epub 2024 Nov 18. (Medline PMID: 39557622)

    Squires KE, Montañez-Miranda C, Pandya RR, Torres MP, Hepler JR. Genetic Analysis of Rare Human Variants of Regulators of G Protein Signaling Proteins and Their Role in Human Physiology and Disease. Pharmacol Rev. 2018 Jul;70(3):446-474. doi: 10.1124/pr.117.015354. (Medline PMCID: 5989036)

    Strain Development
    CRISPR guide(s) and Cas9 protein were microinjected into C57BL/6NCrl zygotes and progeny were screened for the desired mutation. Founders were mated to C57BL/6NCrl breeders (Charles River Stock #027), and derived N1 progeny were identified by PCR and/or sequencing. N1 were then mated again to C57BL/6NCrl breeders to generate N2 mice identified by PCR and/or sequencing. N2 heterozygous mutant mice were mated for production of phenotyping cohorts, and N2 or N2F1 mice were used for cryopreservation purposes.


    Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc_health@med.unc.edu.
    Coat Color
    Black
    Eye
    Black
    MMRRC Breeding System
    Random intra-strain mating
    Generation
    Many over several years. Unknown.
    Overall Breeding Performance
    Good
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Yes Yes
    Homozygotes are fertile: Yes Yes
    Heterozygotes are fertile: N/A N/A
    Age Reproductive Decline: 7 to 9 months 7 to 9 months
    Average litter size
    4 to 6
    Recommended wean age
    4 Weeks
    Average Pups Weaned
    4 to 6

    Order Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    The submitter or their institution limits the distribution to non-profit institutions only.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $)
    *Shipping & Handling not included*
    Units Notes
    075790-UNC-RESUS Litter recovered from cryo-archive $3,242.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

    1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.