Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Hnrnph2em3Lutzy/Mmjax
Stock Number:
075809-JAX
Citation ID:
RRID:MMRRC_075809-JAX
Other Names:
C57BL/6J-Hnrnph2^em3Lutzy/Mmjax

Strain Information

Hnrnph2
Name: heterogeneous nuclear ribonucleoprotein H2
Synonyms: Ftp3, Hnrph2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 56258
HGNC: HGNC:5042
Homologene: 23165
Genetic Alterations
Hnrnph2 knock-out (KO) mice have a 2460bp deletion, including exon 4, of the heterogeneous nuclear ribonucleoprotein H2 (Hnrnph2) gene.
ES Cell Line
Not applicable
Phenotype
Heterozygous females and hemizygous males are viable and fertile with no overt phenotype. Hnrnph2 is an X-linked gene. The donating laboratory indicates that homozygous female mice are born in lower than expected Mendelian ratios from heterozygous x hemizygous breeding (~15.4% of the expected 25%, n=39), but are otherwise viable and fertile.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
  • Cell Biology
  • Neurobiology
Donor
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Not ready to publish
Strain Development
The Hnrnph2 knock-out (KO) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing and was a byproduct when trying to create the HNRNPH2WT allele (RRID:MMRRC 075808-JAX). Guide RNAs (GTATCAGGTCTAATTAACAG, TTATATGGACACACAGTAAC) were selected to excise a 2460bp segment of DNA containing exon 4 of the murine heterogeneous nuclear ribonucleoprotein H2 (Hnrnph2) gene on chromosome X, without replacement. Mouse Hnrnph-202 transcript (ENSMUST00000059297.6) was used as references for the exon number and guide sequences. Guide RNAs, Cas9 nuclease, and the double stranded plasmid donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
N>2
Overall Breeding Performance
Good
NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes X-linked
Homozygotes are fertile: Yes X-linked
Hetero/Hemizygotes are fertile: Yes Yes
Age Reproductive Decline: 7 to 9 months 7 to 9 months
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
075809-JAX-SPERM Cryo-preserved spermatozoa $459.00 / $459.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
075809-JAX-RESUS Litter recovered from cryo-archive $2,123.00 / $2,123.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.