Register New MMRRC Account
Reset Password
Register for New Mouse Models
Click Here for Additional Contact Information
Availability & Fees Order this Strain
1 When indicated as verified ("YES"), then please note that information presented is to the best of our knowledge correct and up-to-date at the time of verification at the MMRRC Distribution Center; however, this information is subject to change due to breeding, maintenance, and other actions on the mouse strain at the MMRRC Distribution Center; direct any questions on this table to the MMRRC Distribution Center for this mouse stain.
2 If verification has not been performed (as indicated by "NO"), investigators may request specific verification testing for a fee. Requests should be submitted directly to the MMRRC Distribution Center assigned to the management, archiving, and distribution of the strain. A full listing of available testing and analytical services is available at https://www.mmrrc.org/about/services.php.
3 This information may or may not apply to each individual engineered allele (e.g., Cre, FlpO) present in the strain.
4 Recovery refers to thawing, in vitro fertilization (IVF), and/or embryo culture leading to live offspring.
A C nucleotide in the Fshb enhancer, located upstream, was targeted for change to T (GRCm39:chr2:106907398C>T) to replicate human SNP rs11031006(G/A) using a crRNA (UGCCCUGUGAUAUUUAUUUC) and an ssODN template with CRISPR/Cas9 technology. The human mutation is associated with Polycystic Ovary Syndrome (PCOS), FSH and LH levels, and the LH/FSH ratio as well as onset of menarche, age of natural menopause, and dizygotic twinning.
Homozygous female mice are subfertile, supporting a functional role for the human rs11031006 variant in human fertility, although no difference was detected in FSH levels.
The homozygous minor allele phenotype is distinct from a PCOS-like model: estrous cyclicity was impaired with age (rather than retained or improved), and the observed lower Lhb transcript level compared to wild type is inconsistent with PCOS, in which LH levels are elevated even in older women of reproductive age (28-31). The observed lower Lhb level with SNP06_G>A also contrasts with human association studies that demonstrate an additive effect of minor allele copy number on serum LH and LH/FSH ratio.
To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.
The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.
Bohaczuk SC, Tonsfeldt KJ, Slaiwa TI, Dunn GA, Gillette DLM, Yeo SE, Shi C, Cassin J, Thackray VG, Mellon PL. A Point Mutation in an Otherwise Dispensable Upstream Fshb Enhancer Moderately Impairs Fertility in Female Mice. Endocrinology. 2025 Apr 22;166(6):bqaf073. doi: 10.1210/endocr/bqaf073. (Medline PMID: 40237337)
Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.
Colony Surveillance Program and Current Health Reports
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
A Commercial License Agreement from the Submitter is required for for-profit entities to use this strain. For more information, please contactDevora Rossi.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
A Commercial License Agreement from the Submitter is required for for-profit entities to use this strain. For more information, please contact Devora Rossi
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.
We use cookies to improve your experience, personalize content, and analyze traffic. By using this site, you agree to our use of cookies. For more details, please visit our Privacy Policy.