Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0032Btlr/Mmmh
Stock Number:
038326-MU
Citation ID:
RRID:MMRRC_038326-MU
Other Names:
R0032 (G1), C57BL/6J-MtgxR0032Btlr
Major Collection:

Strain Information

Dicer1
Name: dicer 1, ribonuclease type III
Synonyms: 1110006F08Rik, D12Ertd7e, Dicer1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 192119
VEGA: 12
Homologene: 13251
Cd86
Name: CD86 antigen
Synonyms: B7-2, MB7-2, B70, Ly-58, Cd28l2, B7.2, Ly58
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12524
HGNC: HGNC:1705
Homologene: 10443
Tjp2
Name: tight junction protein 2
Synonyms: ZO-2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21873
VEGA: 19
Homologene: 3541
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71972
Homologene: 9061
Dnajc21
Name: DnaJ heat shock protein family (Hsp40) member C21
Synonyms: 9930116P15Rik, 4930461P20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78244
Homologene: 6752
Ipo11
Name: importin 11
Synonyms: E330021B14Rik, 1700081H05Rik, 2510001A17Rik, Ranbp11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76582
Homologene: 7089
Cop1
Name: COP1, E3 ubiquitin ligase
Synonyms: Cop1, Rfwd2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26374
Homologene: 115565
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 75,362,166 bp
  • GT to GTT, chromosome 1 at 88,256,166 bp
  • T to C, chromosome 1 at 159,325,036 bp
  • T to C, chromosome 2 at 21,189,304 bp
  • A to T, chromosome 2 at 150,117,592 bp
  • A to G, chromosome 3 at 36,644,256 bp
  • T to A, chromosome 3 at 76,648,435 bp
  • CGCAGCAGCAGCAGCAGCAGCAG to CGCAGCAGCAGCAGCAGCAG, chromosome 3 at 89,520,665 bp
  • T to A, chromosome 3 at 144,816,733 bp
  • T to A, chromosome 4 at 41,015,321 bp
  • A to G, chromosome 4 at 41,768,187 bp
  • T to C, chromosome 4 at 86,828,150 bp
  • T to G, chromosome 4 at 96,568,806 bp
  • T to A, chromosome 4 at 103,366,012 bp
  • A to G, chromosome 5 at 9,511,452 bp
  • G to A, chromosome 5 at 48,256,856 bp
  • A to G, chromosome 5 at 124,800,891 bp
  • G to A, chromosome 5 at 128,743,280 bp
  • G to C, chromosome 5 at 131,440,093 bp
  • G to C, chromosome 5 at 136,985,047 bp
  • T to A, chromosome 5 at 137,831,265 bp
  • T to G, chromosome 6 at 40,895,699 bp
  • T to A, chromosome 6 at 83,273,157 bp
  • C to A, chromosome 6 at 90,107,800 bp
  • T to A, chromosome 6 at 108,076,416 bp
  • A to T, chromosome 6 at 121,225,904 bp
  • T to C, chromosome 6 at 121,473,130 bp
  • T to A, chromosome 6 at 124,039,899 bp
  • A to G, chromosome 6 at 148,810,711 bp
  • T to C, chromosome 7 at 11,931,267 bp
  • C to A, chromosome 7 at 16,182,285 bp
  • T to A, chromosome 7 at 16,434,640 bp
  • T to C, chromosome 7 at 25,245,075 bp
  • C to T, chromosome 7 at 28,541,292 bp
  • T to C, chromosome 7 at 41,399,733 bp
  • T to A, chromosome 7 at 46,288,213 bp
  • G to A, chromosome 7 at 46,304,231 bp
  • A to G, chromosome 7 at 59,985,082 bp
  • C to A, chromosome 7 at 67,733,927 bp
  • T to C, chromosome 7 at 99,582,265 bp
  • T to A, chromosome 7 at 100,444,445 bp
  • A to G, chromosome 7 at 104,336,577 bp
  • T to C, chromosome 7 at 142,439,189 bp
  • A to T, chromosome 7 at 143,085,241 bp
  • T to C, chromosome 8 at 84,977,786 bp
  • G to A, chromosome 8 at 110,892,103 bp
  • C to A, chromosome 9 at 21,201,432 bp
  • A to G, chromosome 9 at 38,180,608 bp
  • T to C, chromosome 9 at 62,774,095 bp
  • A to G, chromosome 9 at 108,561,661 bp
  • G to T, chromosome 9 at 110,637,868 bp
  • C to T, chromosome 10 at 92,932,697 bp
  • T to A, chromosome 10 at 107,123,295 bp
  • T to C, chromosome 10 at 117,744,932 bp
  • T to A, chromosome 10 at 129,660,400 bp
  • T to C, chromosome 11 at 7,144,729 bp
  • G to T, chromosome 11 at 82,753,643 bp
  • A to T, chromosome 11 at 96,908,753 bp
  • C to T, chromosome 11 at 100,746,932 bp
  • T to C, chromosome 12 at 80,592,469 bp
  • G to A, chromosome 12 at 83,535,988 bp
  • A to G, chromosome 12 at 85,245,749 bp
  • A to T, chromosome 12 at 104,704,798 bp
  • C to T, chromosome 13 at 100,303,237 bp
  • A to C, chromosome 13 at 106,834,463 bp
  • G to T, chromosome 14 at 51,919,409 bp
  • T to A, chromosome 14 at 56,101,739 bp
  • G to T, chromosome 15 at 10,461,877 bp
  • T to C, chromosome 15 at 82,079,913 bp
  • T to A, chromosome 15 at 90,569,568 bp
  • T to A, chromosome 15 at 101,761,452 bp
  • T to C, chromosome 15 at 101,794,052 bp
  • C to T, chromosome 16 at 20,685,898 bp
  • A to T, chromosome 16 at 29,615,069 bp
  • A to T, chromosome 16 at 36,620,873 bp
  • T to C, chromosome 17 at 7,336,907 bp
  • G to A, chromosome 17 at 20,945,584 bp
  • A to G, chromosome 17 at 21,692,056 bp
  • T to A, chromosome 17 at 34,212,225 bp
  • G to A, chromosome 17 at 35,555,555 bp
  • T to A, chromosome 17 at 37,672,487 bp
  • G to T, chromosome 17 at 69,210,384 bp
  • T to G, chromosome 18 at 66,291,652 bp
  • T to G, chromosome 18 at 73,794,525 bp
  • T to C, chromosome 19 at 17,564,815 bp
  • A to G, chromosome 19 at 24,108,695 bp
  • A to C, chromosome 19 at 43,902,719 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0032 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038326-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.