Strain Name:
C57BL/6J-MtgxR0032Btlr/Mmmh
Stock Number:
038326-MU
Citation ID:
RRID:MMRRC_038326-MU
Other Names:
R0032 (G1), C57BL/6J-MtgxR0032Btlr
Major Collection:

Strain Information

Dicer1
Name: dicer 1, ribonuclease type III
Synonyms: 1110006F08Rik, D12Ertd7e, Dicer1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 192119
VEGA: 12
Homologene: 13251
Cd86
Name: CD86 antigen
Synonyms: B7-2, MB7-2, B70, Ly-58, Cd28l2, B7.2, Ly58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12524
HGNC: HGNC:1705
Homologene: 10443
Tjp2
Name: tight junction protein 2
Synonyms: ZO-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 21873
VEGA: 19
Homologene: 3541
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71972
Homologene: 9061
Dnajc21
Name: DnaJ heat shock protein family (Hsp40) member C21
Synonyms: 9930116P15Rik, 4930461P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 78244
Homologene: 6752
Ipo11
Name: importin 11
Synonyms: E330021B14Rik, 1700081H05Rik, 2510001A17Rik, Ranbp11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 76582
Homologene: 7089
Cop1
Name: COP1, E3 ubiquitin ligase
Synonyms: Cop1, Rfwd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 26374
Homologene: 115565
Zc3h4
Name: zinc finger CCCH-type containing 4
Synonyms: LOC330474, Bwq1, Kiaa1064-hp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330474
Homologene: 87150
Auts2
Name: autism susceptibility candidate 2
Synonyms: D830032G16Rik, A730011F23Rik, 2700063G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 319974
Homologene: 22907
Nfx1
Name: nuclear transcription factor, X-box binding 1
Synonyms: TEG-42, 1300017N15Rik, 3000003M19Rik, Tex42
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74164
HGNC: HGNC:7803
Homologene: 1875
Epb41l3
Name: erythrocyte membrane protein band 4.1 like 3
Synonyms: NBL3, 4.1B, DAL1P, Epb4.1l3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 13823
HGNC: HGNC:3380
Homologene: 49308
Opa1
Name: OPA1, mitochondrial dynamin like GTPase
Synonyms: 1200011N24Rik, lilr3, optic atrophy 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74143
HGNC: HGNC:8140
Homologene: 14618
Dennd4c
Name: DENN domain containing 4C
Synonyms: 1700065A05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329877
Homologene: 23057
Dcaf4
Name: DDB1 and CUL4 associated factor 4
Synonyms: 1110018E21Rik, Wdr21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 73828
VEGA: 12
Homologene: 9210
Ppp2r1a
Name: protein phosphatase 2, regulatory subunit A, alpha
Synonyms: PR65, protein phosphatase PP2A, 6330556D22Rik, PP2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 51792
HGNC: HGNC:9302
Homologene: 68559
Mlh3
Name: mutL homolog 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217716
VEGA: 12
HGNC: HGNC:7128
Homologene: 91153
Ipo8
Name: importin 8
Synonyms: OM-1, 6230418K12Rik, Om1, C130009K11Rik, Ranbp8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 320727
HGNC: HGNC:9853
Homologene: 48430
Znhit1
Name: zinc finger, HIT domain containing 1
Synonyms: 2700001K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70103
Homologene: 4630
C2cd3
Name: C2 calcium-dependent domain containing 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 277939
Homologene: 19524
Piwil1
Name: piwi-like RNA-mediated gene silencing 1
Synonyms: MIWI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 57749
HGNC: HGNC:9007
Homologene: 37963
Slit2
Name: slit guidance ligand 2
Synonyms: Slil3, Drad-1, E130320P19Rik, E030015M03Rik, b2b1200.1Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20563
Homologene: 3516
Iqsec3
Name: IQ motif and Sec7 domain 3
Synonyms: BRAG3, synarfGEF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243621
Homologene: 46091
Adcy1
Name: adenylate cyclase 1
Synonyms: AC1, I-AC, D11Bwg1392e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 432530
HGNC: HGNC:232
Homologene: 41419
Impdh2
Name: inosine monophosphate dehydrogenase 2
Synonyms: IMP dehydrogenase type II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 23918
HGNC: HGNC:6053
Homologene: 48919
Erf
Name: Ets2 repressor factor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13875
HGNC: HGNC:3444
Homologene: 68516
Eif4g1
Name: eukaryotic translation initiation factor 4, gamma 1
Synonyms: E030015G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 208643
HGNC: HGNC:3296
Homologene: 110725
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 74369
Homologene: 46535
Oma1
Name: OMA1 zinc metallopeptidase
Synonyms: 2010001O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67013
Homologene: 12070
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235627
Homologene: 86422
Prss58
Name: serine protease 58
Synonyms: BC048599
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232717
Homologene: 65285
Ccbe1
Name: collagen and calcium binding EGF domains 1
Synonyms: 9430093N24Rik, 4933426F18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 320924
Homologene: 15852
Slc35e3
Name: solute carrier family 35, member E3
Synonyms: 9330166G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215436
VEGA: 10
Homologene: 41279
Pde4a
Name: phosphodiesterase 4A, cAMP specific
Synonyms: dunce, Dpde2, D9Ertd60e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 18577
HGNC: HGNC:8780
Homologene: 4520
Me2
Name: malic enzyme 2, NAD(+)-dependent, mitochondrial
Synonyms: D030040L20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 107029
VEGA: 18
HGNC: HGNC:6984
Homologene: 37615
Krt74
Name: keratin 74
Synonyms: Kb37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 406222
VEGA: 15
Itga11
Name: integrin alpha 11
Synonyms: 4732459H24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319480
HGNC: HGNC:6136
Homologene: 8151
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Fstl5
Name: follistatin-like 5
Synonyms: 9130207J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 213262
Homologene: 10584
Pcsk5
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: PC6, SPC6, PC5A, PC5/6A, b2b585Clo, b2b1549Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18552
VEGA: 19
HGNC: HGNC:8747
Homologene: 21244
Vmn2r57
Name: vomeronasal 2, receptor 57
Synonyms: EG269902
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269902
Homologene: 104832
Fcsk
Name: fucose kinase
Synonyms: L-fucose kinase, 1110046B12Rik, Fuk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234730
Homologene: 15452
Gm872
Name: predicted gene 872
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Il11ra1
Name: interleukin 11 receptor subunit alpha 1
Synonyms: NR1, Il11ra, Il-11ra-alpha, Il-11ra
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16157
HGNC: HGNC:5967
Homologene: 88705
Kcnn3
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonyms: small conductance calcium-activated potassium channel 3, SK3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 140493
HGNC: HGNC:6292
Homologene: 20516
Cpne8
Name: copine VIII
Synonyms: 1200003E11Rik, 1500031E20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66871
Homologene: 12049
Des
Name: desmin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13346
HGNC: HGNC:2770
Homologene: 56469
Mroh2a
Name: maestro heat-like repeat family member 2A
Synonyms: ENSMUSG00000044873, OTTMUSG00000020804, Heatr7b1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100040766
Homologene: 85300
Enkur
Name: enkurin, TRPC channel interacting protein
Synonyms: 4933434I06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 71233
Homologene: 17022
Zfp120
Name: zinc finger protein 120
Synonyms: MZF31, E030042N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 104348
Homologene: 138454
Trpc3
Name: transient receptor potential cation channel, subfamily C, member 3
Synonyms: Trp3, Trrp3, Trcp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 22065
Homologene: 20708
Clca3a2
Name: chloride channel accessory 3A2
Synonyms: Clca2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 80797
Homologene: 77224
Cyp2j9
Name: cytochrome P450, family 2, subfamily j, polypeptide 9
Synonyms: 8430417E17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74519
HGNC: HGNC:2634
Homologene: 137388
Grm3
Name: glutamate receptor, metabotropic 3
Synonyms: mGluR3, 0710001G23Rik, Gprc1c, mGlu3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 108069
HGNC: HGNC:4595
Homologene: 651
Pilra
Name: paired immunoglobin-like type 2 receptor alpha
Synonyms: FDF03
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231805
Homologene: 8387
Slc4a5
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 5
Synonyms: C330016K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232156
Homologene: 31125
Vmn1r50
Name: vomeronasal 1 receptor 50
Synonyms: VN2, V1rb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 113852
Homologene: 113975
Setmar
Name: SET domain without mariner transposase fusion
Synonyms: 5830404F24Rik, Etet2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 74729
Homologene: 68519
Tuba8
Name: tubulin, alpha 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 53857
Homologene: 56766
Vmn2r26
Name: vomeronasal 2, receptor 26
Synonyms: V2r1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56552
Homologene: 135915
Vmn1r76
Name: vomeronasal 1 receptor 76
Synonyms: V1rg4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 171239
Meis3
Name: Meis homeobox 3
Synonyms: Mrg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17537
Homologene: 7425
Sycn
Name: syncollin
Synonyms: 0910001K16Rik, 1810038B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68416
Homologene: 12266
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Snrpn
Name: small nuclear ribonucleoprotein N
Synonyms: Peg4, 2410045I01Rik, Pwcr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20646
Homologene: 68297
Synm
Name: synemin, intermediate filament protein
Synonyms: 4930412K21Rik, Synemin, Dmn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233335
Homologene: 9081
Arrb1
Name: arrestin, beta 1
Synonyms: 1200006I17Rik, beta-arrestin1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 109689
HGNC: HGNC:711
Homologene: 2981
Trim34b
Name: tripartite motif-containing 34B
Synonyms: Trim34-2, Gm15134
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 434218
Homologene: 128238
Syt8
Name: synaptotagmin VIII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 55925
Homologene: 10302
Trpm5
Name: transient receptor potential cation channel, subfamily M, member 5
Synonyms: Mtr1, Ltrpc5, 9430099A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56843
Homologene: 22818
Junb
Name: jun B proto-oncogene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16477
HGNC: HGNC:6205
Homologene: 7390
Or8c13
Name: olfactory receptor family 8 subfamily C member 13
Synonyms: GA_x6K02T2PVTD-31862167-31861217, MOR170-9, Olfr891
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258471
Homologene: 74210
Acss3
Name: acyl-CoA synthetase short-chain family member 3
Synonyms: LOC380660, 8430416H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 380660
Homologene: 11587
Or6c210
Name: olfactory receptor family 6 subfamily C member 210
Synonyms: GA_x6K02T2PULF-11338429-11339364, MOR114-7, Olfr800
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258541
Homologene: 27203
Cct6b
Name: chaperonin containing TCP1 subunit 6B
Synonyms: CCTzeta-2, Cctz-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12467
HGNC: HGNC:1621
Homologene: 55978
Cdk5rap3
Name: CDK5 regulatory subunit associated protein 3
Synonyms: 1810007E24Rik, OK/SW-cl.114, MST016, HSF-27, IC53, C53
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 80280
Homologene: 12718
Kcnh4
Name: potassium voltage-gated channel, subfamily H (eag-related), member 4
Synonyms: BEC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380728
HGNC: HGNC:6253
Homologene: 8180
Galnt16
Name: polypeptide N-acetylgalactosaminyltransferase 16
Synonyms: 5730405L21Rik, Galntl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 108760
VEGA: 12
Homologene: 18907
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Naip-rs4, Birc1f
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Tppp2
Name: tubulin polymerization-promoting protein family member 2
Synonyms: LOC219038, LOC386487
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219038
VEGA: 14
Homologene: 25079
Ctsg
Name: cathepsin G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 13035
VEGA: 14
HGNC: HGNC:2532
Homologene: 105646
Krt73
Name: keratin 73
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223915
Homologene: 27875
Tcp10a
Name: t-complex protein 10a
Synonyms: T66A-a, D17Leh66aa, D17Leh66A, Tcp-10a, Gm10326
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 21461
Homologene: 83254
Gm10226
Name: predicted gene 10226
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Gm15821
Name: predicted gene 15821
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Cdsn
Name: corneodesmosin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 386463
HGNC: HGNC:1802
Or10al2
Name: olfactory receptor family 10 subfamily AL member 2
Synonyms: GA_x6K02T2PSCP-2131124-2132089, MOR263-13, Olfr118
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 404308
Homologene: 110622
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 75,362,166 bp
  • GT to GTT, chromosome 1 at 88,256,166 bp
  • T to C, chromosome 1 at 159,325,036 bp
  • T to C, chromosome 2 at 21,189,304 bp
  • A to T, chromosome 2 at 150,117,592 bp
  • A to G, chromosome 3 at 36,644,256 bp
  • T to A, chromosome 3 at 76,648,435 bp
  • CGCAGCAGCAGCAGCAGCAGCAG to CGCAGCAGCAGCAGCAGCAG, chromosome 3 at 89,520,665 bp
  • T to A, chromosome 3 at 144,816,733 bp
  • T to A, chromosome 4 at 41,015,321 bp
  • A to G, chromosome 4 at 41,768,187 bp
  • T to C, chromosome 4 at 86,828,150 bp
  • T to G, chromosome 4 at 96,568,806 bp
  • T to A, chromosome 4 at 103,366,012 bp
  • A to G, chromosome 5 at 9,511,452 bp
  • G to A, chromosome 5 at 48,256,856 bp
  • A to G, chromosome 5 at 124,800,891 bp
  • G to A, chromosome 5 at 128,743,280 bp
  • G to C, chromosome 5 at 131,440,093 bp
  • G to C, chromosome 5 at 136,985,047 bp
  • T to A, chromosome 5 at 137,831,265 bp
  • T to G, chromosome 6 at 40,895,699 bp
  • T to A, chromosome 6 at 83,273,157 bp
  • C to A, chromosome 6 at 90,107,800 bp
  • T to A, chromosome 6 at 108,076,416 bp
  • A to T, chromosome 6 at 121,225,904 bp
  • T to C, chromosome 6 at 121,473,130 bp
  • T to A, chromosome 6 at 124,039,899 bp
  • A to G, chromosome 6 at 148,810,711 bp
  • T to C, chromosome 7 at 11,931,267 bp
  • C to A, chromosome 7 at 16,182,285 bp
  • T to A, chromosome 7 at 16,434,640 bp
  • T to C, chromosome 7 at 25,245,075 bp
  • C to T, chromosome 7 at 28,541,292 bp
  • T to C, chromosome 7 at 41,399,733 bp
  • T to A, chromosome 7 at 46,288,213 bp
  • G to A, chromosome 7 at 46,304,231 bp
  • A to G, chromosome 7 at 59,985,082 bp
  • C to A, chromosome 7 at 67,733,927 bp
  • T to C, chromosome 7 at 99,582,265 bp
  • T to A, chromosome 7 at 100,444,445 bp
  • A to G, chromosome 7 at 104,336,577 bp
  • T to C, chromosome 7 at 142,439,189 bp
  • A to T, chromosome 7 at 143,085,241 bp
  • T to C, chromosome 8 at 84,977,786 bp
  • G to A, chromosome 8 at 110,892,103 bp
  • C to A, chromosome 9 at 21,201,432 bp
  • A to G, chromosome 9 at 38,180,608 bp
  • T to C, chromosome 9 at 62,774,095 bp
  • A to G, chromosome 9 at 108,561,661 bp
  • G to T, chromosome 9 at 110,637,868 bp
  • C to T, chromosome 10 at 92,932,697 bp
  • T to A, chromosome 10 at 107,123,295 bp
  • T to C, chromosome 10 at 117,744,932 bp
  • T to A, chromosome 10 at 129,660,400 bp
  • T to C, chromosome 11 at 7,144,729 bp
  • G to T, chromosome 11 at 82,753,643 bp
  • A to T, chromosome 11 at 96,908,753 bp
  • C to T, chromosome 11 at 100,746,932 bp
  • T to C, chromosome 12 at 80,592,469 bp
  • G to A, chromosome 12 at 83,535,988 bp
  • A to G, chromosome 12 at 85,245,749 bp
  • A to T, chromosome 12 at 104,704,798 bp
  • C to T, chromosome 13 at 100,303,237 bp
  • A to C, chromosome 13 at 106,834,463 bp
  • G to T, chromosome 14 at 51,919,409 bp
  • T to A, chromosome 14 at 56,101,739 bp
  • G to T, chromosome 15 at 10,461,877 bp
  • T to C, chromosome 15 at 82,079,913 bp
  • T to A, chromosome 15 at 90,569,568 bp
  • T to A, chromosome 15 at 101,761,452 bp
  • T to C, chromosome 15 at 101,794,052 bp
  • C to T, chromosome 16 at 20,685,898 bp
  • A to T, chromosome 16 at 29,615,069 bp
  • A to T, chromosome 16 at 36,620,873 bp
  • T to C, chromosome 17 at 7,336,907 bp
  • G to A, chromosome 17 at 20,945,584 bp
  • A to G, chromosome 17 at 21,692,056 bp
  • T to A, chromosome 17 at 34,212,225 bp
  • G to A, chromosome 17 at 35,555,555 bp
  • T to A, chromosome 17 at 37,672,487 bp
  • G to T, chromosome 17 at 69,210,384 bp
  • T to G, chromosome 18 at 66,291,652 bp
  • T to G, chromosome 18 at 73,794,525 bp
  • T to C, chromosome 19 at 17,564,815 bp
  • A to G, chromosome 19 at 24,108,695 bp
  • A to C, chromosome 19 at 43,902,719 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0032 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038326-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.