Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0080Btlr/Mmmh
Stock Number:
038367-MU
Citation ID:
RRID:MMRRC_038367-MU
Other Names:
R0080 (G1), C57BL/6J-MtgxR0080Btlr
Major Collection:

Strain Information

Gnb5
Name: guanine nucleotide binding protein (G protein), beta 5
Synonyms: G beta 5, Gbeta5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14697
VEGA: 9
HGNC: HGNC:4401
Homologene: 40714
Irx3
Name: Iroquois related homeobox 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16373
Homologene: 7385
Nos1
Name: nitric oxide synthase 1, neuronal
Synonyms: nNOS, bNOS, Nos-1, NO, 2310005C01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18125
HGNC: HGNC:7872
Homologene: 37327
Snta1
Name: syntrophin, acidic 1
Synonyms: alpha1-syntrophin, Snt1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20648
Homologene: 2331
Kcmf1
Name: potassium channel modulatory factor 1
Synonyms: clone DEBT-91, 1700094M07Rik, Pmcf
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74287
Homologene: 99845
Odf2l
Name: outer dense fiber of sperm tails 2-like
Synonyms: 4733401D09Rik, 9630045K08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 52184
Homologene: 12011
Srek1
Name: splicing regulatory glutamine/lysine-rich protein 1
Synonyms: SRrp508, SRrp86, Sfrs12, AL118220
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218543
Homologene: 10581
Coro7
Name: coronin 7
Synonyms: 0610011B16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78885
Homologene: 11573
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Adcy1
Name: adenylate cyclase 1
Synonyms: AC1, I-AC, D11Bwg1392e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432530
HGNC: HGNC:232
Homologene: 41419
Oas1d
Name: 2'-5' oligoadenylate synthetase 1D
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100535
HGNC: HGNC:8086
Homologene: 110815
Adam17
Name: a disintegrin and metallopeptidase domain 17
Synonyms: Tace, CD156b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11491
HGNC: HGNC:195
Homologene: 2395
Grk6
Name: G protein-coupled receptor kinase 6
Synonyms: Gprk6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26385
VEGA: 13
HGNC: HGNC:4545
Homologene: 37570
Med23
Name: mediator complex subunit 23
Synonyms: ESTM7, 3000002A17Rik, X83317, Crsp3, Sur2, sno
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70208
HGNC: HGNC:2372
Homologene: 3552
Zfp445
Name: zinc finger protein 445
Synonyms: ZNF168
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235682
VEGA: 9
Homologene: 27832
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Myl3
Name: myosin, light polypeptide 3
Synonyms: MLC1v, MLC1s, Mylc, slow skeletal, ventricular, alkali
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17897
HGNC: HGNC:7584
Homologene: 20099
Ncoa6
Name: nuclear receptor coactivator 6
Synonyms: PRIP, ASC2, RAP250, AIB3, NRC, ASC-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56406
Homologene: 137337
Gpr179
Name: G protein-coupled receptor 179
Synonyms: 5330439C02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217143
Homologene: 34917
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381522
Homologene: 117988
Trim60
Name: tripartite motif-containing 60
Synonyms: 2czf45, Rnf33
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234329
Homologene: 51876
Ednra
Name: endothelin receptor type A
Synonyms: ETa, ET-AR, Gpcr10, AEA001, Mhdaaea1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13617
HGNC: HGNC:3179
Homologene: 1478
Tie1
Name: tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Synonyms: TIE, D430008P04Rik, tie-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21846
Homologene: 3957
D2hgdh
Name: D-2-hydroxyglutarate dehydrogenase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98314
Homologene: 5534
Golgb1
Name: golgin B1
Synonyms: Giantin, C130074L01Rik, F730017E11Rik, 6330407A06Rik, Gm6840
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224139
HGNC: HGNC:4429
Homologene: 68401
Pign
Name: phosphatidylinositol glycan anchor biosynthesis, class N
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27392
HGNC: HGNC:8967
Homologene: 6330
Pfkfb2
Name: 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Synonyms: PFK-2/FBPase-2 gene B, 4930568D07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18640
HGNC: HGNC:8873
Homologene: 88554
Or5m5
Name: olfactory receptor family 5 subfamily M member 5
Synonyms: GA_x6K02T2Q125-47462755-47463693, MOR196-2, Olfr1030
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258581
Homologene: 64892
Tmem144
Name: transmembrane protein 144
Synonyms: 1110057I03Rik, 5730537D05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70652
Homologene: 41250
Tigd4
Name: tigger transposable element derived 4
Synonyms: Tigd4, C130063O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 403175
Homologene: 131124
Wdr91
Name: WD repeat domain 91
Synonyms: 9530020G05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101240
Homologene: 8562
AC145553.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Hoatz
Name: HOATZ cilia and flagella associated protein
Synonyms: 4833427G06Rik, Hoatzin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235345
VEGA: 9
Homologene: 52243
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Col6a5, Gm7455
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 665033
Homologene: 122792
Pomgnt2
Name: protein O-linked mannose beta 1,4-N-acetylglucosaminyltransferase 2
Synonyms: C85492, Gtdc2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215494
VEGA: 9
Homologene: 32795
Adgb
Name: androglobin
Synonyms: 9130014G24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215772
Homologene: 100289
Slc35d3
Name: solute carrier family 35, member D3
Synonyms: 6230421J19Rik, Frcl1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76157
VEGA: 10
Homologene: 19123
Vmn2r82
Name: vomeronasal 2, receptor 82
Synonyms: EG624845
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624845
Homologene: 83483
Jsrp1
Name: junctional sarcoplasmic reticulum protein 1
Synonyms: JP-45, 2310032K21Rik, 2300003C06Rik, JP45
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71912
Homologene: 12422
4732465J04Rik
Name: RIKEN cDNA 4732465J04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 414105
Or6c1b
Name: olfactory receptor family 6 subfamily C member 1B
Synonyms: GA_x6K02T2PULF-11116958-11117896, MOR111-5, Olfr786
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258542
HGNC: HGNC:8355
Homologene: 133582
Or6c209
Name: olfactory receptor family 6 subfamily C member 209
Synonyms: GA_x6K02T2PULF-11325750-11326685, MOR114-2, Olfr799
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258929
Homologene: 37000
Ggt6
Name: gamma-glutamyltransferase 6
Synonyms: 9030405D14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71522
Homologene: 51918
Antkmt
Name: adenine nucleotide translocase lysine methyltransferase
Synonyms: Fam173a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 214917
VEGA: 17
Homologene: 11398
Dsg1b
Name: desmoglein 1 beta
Synonyms: Dsg5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225256
HGNC: HGNC:3048
Homologene: 1463
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 93,826,455 bp
  • G to T, chromosome 1 at 105,552,405 bp
  • A to T, chromosome 1 at 130,714,542 bp
  • A to G, chromosome 2 at 85,983,839 bp
  • A to G, chromosome 2 at 154,383,837 bp
  • TGC to TGCGC, chromosome 2 at 155,408,291 bp
  • G to A, chromosome 3 at 79,839,273 bp
  • A to G, chromosome 3 at 84,594,145 bp
  • A to T, chromosome 3 at 145,124,323 bp
  • A to G, chromosome 4 at 45,896,205 bp
  • T to A, chromosome 4 at 118,484,353 bp
  • G to T, chromosome 5 at 117,893,878 bp
  • G to A, chromosome 5 at 120,916,892 bp
  • A to G, chromosome 5 at 121,349,372 bp
  • A to T, chromosome 5 at 143,195,675 bp
  • T to C, chromosome 6 at 34,906,685 bp
  • G to T, chromosome 6 at 72,850,487 bp
  • A to G, chromosome 7 at 33,287,642 bp
  • C to T, chromosome 8 at 65,000,599 bp
  • T to C, chromosome 8 at 77,675,059 bp
  • T to C, chromosome 8 at 91,800,326 bp
  • T to C, chromosome 9 at 51,101,802 bp
  • A to T, chromosome 9 at 75,314,354 bp
  • C to T, chromosome 9 at 105,889,335 bp
  • A to C, chromosome 9 at 110,767,929 bp
  • A to T, chromosome 9 at 121,982,260 bp
  • A to G, chromosome 9 at 122,852,356 bp
  • T to C, chromosome 10 at 10,377,839 bp
  • T to C, chromosome 10 at 19,849,198 bp
  • T to C, chromosome 10 at 24,912,817 bp
  • A to T, chromosome 10 at 79,396,505 bp
  • T to G, chromosome 10 at 80,810,515 bp
  • GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC to GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC, chromosome 10 at 95,794,578 bp
  • T to C, chromosome 10 at 129,437,271 bp
  • G to A, chromosome 10 at 129,647,653 bp
  • T to C, chromosome 11 at 7,149,497 bp
  • A to G, chromosome 11 at 72,437,195 bp
  • A to G, chromosome 11 at 97,351,469 bp
  • A to C, chromosome 12 at 21,329,048 bp
  • T to A, chromosome 13 at 11,568,475 bp
  • T to C, chromosome 13 at 55,458,910 bp
  • T to C, chromosome 13 at 103,743,686 bp
  • A to T, chromosome 16 at 4,630,464 bp
  • T to C, chromosome 16 at 36,898,611 bp
  • T to C, chromosome 17 at 25,791,574 bp
  • T to G, chromosome 18 at 20,397,367 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0080 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038367-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.