Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0309Btlr/Mmmh
Stock Number:
038519-MU
Citation ID:
RRID:MMRRC_038519-MU
Other Names:
R0309 (G1), C57BL/6J-MtgxR0309Btlr
Major Collection:

Strain Information

Prrx1
Name: paired related homeobox 1
Synonyms: K-2, Prx1, mHox, Pmx1, mHox, A230024N07Rik, MHox1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18933
HGNC: HGNC:9142
Homologene: 7896
Pik3cd
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
Synonyms: p110delta, 2410099E07Rik, 2610208K16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18707
HGNC: HGNC:8977
Homologene: 3686
Kdm4c
Name: lysine (K)-specific demethylase 4C
Synonyms: 2410141F18Rik, Jmjd2c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76804
Homologene: 41004
Nfib
Name: nuclear factor I/B
Synonyms: 6720429L07Rik, E030026I10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18028
HGNC: HGNC:7785
Homologene: 4087
Sgpl1
Name: sphingosine phosphate lyase 1
Synonyms: D10Xrf456
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20397
Homologene: 2897
Map3k4
Name: mitogen-activated protein kinase kinase kinase 4
Synonyms: MTK1, MAPKKK4, D17Rp17, RP17, D17Rp17e, Mekk4, T-associated sex reversal, Tas
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26407
VEGA: 17
HGNC: HGNC:6856
Homologene: 31346
B3gnt2
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Synonyms: B3Galt6, B3gnt1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53625
Homologene: 4797
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 21,264,894 bp
  • A to C, chromosome 1 at 33,734,861 bp
  • C to G, chromosome 1 at 53,405,690 bp
  • T to C, chromosome 1 at 58,413,033 bp
  • A to G, chromosome 1 at 72,307,576 bp
  • C to A, chromosome 1 at 132,456,864 bp
  • T to C, chromosome 1 at 139,438,984 bp
  • T to C, chromosome 1 at 139,482,511 bp
  • T to A, chromosome 1 at 153,077,001 bp
  • A to T, chromosome 1 at 153,465,695 bp
  • T to C, chromosome 1 at 156,442,453 bp
  • T to C, chromosome 1 at 163,312,559 bp
  • T to C, chromosome 1 at 172,234,987 bp
  • T to C, chromosome 1 at 177,448,616 bp
  • T to A, chromosome 1 at 178,475,904 bp
  • T to C, chromosome 2 at 24,987,195 bp
  • A to C, chromosome 2 at 26,986,989 bp
  • C to T, chromosome 2 at 33,157,923 bp
  • T to C, chromosome 2 at 35,376,259 bp
  • A to T, chromosome 2 at 37,379,008 bp
  • G to T, chromosome 2 at 72,226,030 bp
  • A to T, chromosome 2 at 122,517,553 bp
  • T to C, chromosome 2 at 153,959,683 bp
  • T to C, chromosome 2 at 155,630,672 bp
  • T to C, chromosome 2 at 165,395,992 bp
  • G to A, chromosome 3 at 81,944,861 bp
  • C to T, chromosome 3 at 132,734,407 bp
  • G to C, chromosome 3 at 141,733,933 bp
  • T to C, chromosome 4 at 43,640,904 bp
  • T to C, chromosome 4 at 74,345,567 bp
  • T to A, chromosome 4 at 82,296,737 bp
  • T to C, chromosome 4 at 99,034,469 bp
  • T to C, chromosome 4 at 102,915,157 bp
  • T to C, chromosome 4 at 111,938,867 bp
  • T to A, chromosome 4 at 114,844,976 bp
  • T to G, chromosome 4 at 118,446,038 bp
  • T to C, chromosome 4 at 126,443,166 bp
  • A to T, chromosome 4 at 149,663,220 bp
  • G to A, chromosome 4 at 150,158,071 bp
  • A to G, chromosome 5 at 4,069,038 bp
  • A to C, chromosome 5 at 8,939,835 bp
  • G to T, chromosome 5 at 24,434,346 bp
  • T to C, chromosome 5 at 63,807,218 bp
  • A to G, chromosome 5 at 66,310,988 bp
  • A to G, chromosome 5 at 75,946,927 bp
  • G to A, chromosome 5 at 89,583,347 bp
  • A to G, chromosome 5 at 91,032,214 bp
  • T to C, chromosome 5 at 114,419,469 bp
  • A to G, chromosome 6 at 3,536,853 bp
  • A to G, chromosome 6 at 57,703,132 bp
  • G to A, chromosome 6 at 78,406,186 bp
  • A to T, chromosome 6 at 83,519,914 bp
  • G to A, chromosome 6 at 100,573,627 bp
  • T to C, chromosome 6 at 123,386,104 bp
  • A to C, chromosome 6 at 132,893,378 bp
  • C to T, chromosome 7 at 29,348,350 bp
  • A to T, chromosome 7 at 43,694,345 bp
  • A to T, chromosome 7 at 45,308,706 bp
  • T to C, chromosome 7 at 47,079,294 bp
  • T to C, chromosome 7 at 83,722,554 bp
  • A to C, chromosome 7 at 102,152,428 bp
  • T to A, chromosome 7 at 103,212,721 bp
  • T to A, chromosome 7 at 118,529,717 bp
  • A to T, chromosome 7 at 128,205,935 bp
  • G to A, chromosome 8 at 13,795,500 bp
  • G to A, chromosome 8 at 21,065,855 bp
  • A to T, chromosome 8 at 23,104,809 bp
  • C to T, chromosome 8 at 48,341,034 bp
  • G to A, chromosome 8 at 72,200,460 bp
  • A to G, chromosome 8 at 84,721,774 bp
  • C to A, chromosome 8 at 84,843,031 bp
  • A to G, chromosome 8 at 116,997,576 bp
  • T to A, chromosome 8 at 126,438,928 bp
  • A to T, chromosome 8 at 127,376,897 bp
  • A to G, chromosome 9 at 57,110,912 bp
  • T to A, chromosome 9 at 79,600,011 bp
  • A to G, chromosome 10 at 34,044,047 bp
  • A to G, chromosome 10 at 58,479,868 bp
  • C to T, chromosome 10 at 61,113,437 bp
  • T to C, chromosome 10 at 120,937,110 bp
  • A to G, chromosome 10 at 122,920,782 bp
  • A to G, chromosome 10 at 129,705,139 bp
  • A to T, chromosome 11 at 22,836,860 bp
  • C to A, chromosome 11 at 66,026,972 bp
  • C to T, chromosome 11 at 69,357,018 bp
  • T to C, chromosome 12 at 30,226,773 bp
  • T to C, chromosome 13 at 13,965,667 bp
  • C to A, chromosome 13 at 51,725,311 bp
  • T to C, chromosome 13 at 55,724,582 bp
  • T to A, chromosome 13 at 64,757,436 bp
  • A to T, chromosome 13 at 69,499,932 bp
  • A to C, chromosome 14 at 28,141,225 bp
  • T to G, chromosome 14 at 50,891,411 bp
  • C to A, chromosome 14 at 101,729,693 bp
  • A to G, chromosome 15 at 27,567,572 bp
  • A to G, chromosome 15 at 33,594,151 bp
  • C to T, chromosome 15 at 36,597,493 bp
  • A to G, chromosome 15 at 78,976,540 bp
  • A to T, chromosome 15 at 93,441,707 bp
  • T to C, chromosome 16 at 5,031,972 bp
  • G to A, chromosome 16 at 11,997,123 bp
  • T to C, chromosome 16 at 18,219,305 bp
  • A to C, chromosome 16 at 34,912,297 bp
  • C to T, chromosome 16 at 55,925,058 bp
  • A to T, chromosome 16 at 78,334,948 bp
  • T to A, chromosome 16 at 93,884,511 bp
  • TGCTGGCTTCAGGGCCACAGTCCGCTG to TGCTG, chromosome 17 at 12,271,015 bp
  • G to A, chromosome 17 at 15,557,384 bp
  • T to C, chromosome 17 at 24,678,584 bp
  • A to G, chromosome 17 at 35,150,915 bp
  • G to T, chromosome 17 at 57,081,182 bp
  • A to G, chromosome 17 at 64,139,016 bp
  • A to T, chromosome 17 at 67,901,429 bp
  • A to G, chromosome 17 at 80,274,881 bp
  • G to T, chromosome 18 at 37,436,121 bp
  • G to A, chromosome 18 at 61,155,128 bp
  • T to C, chromosome 19 at 5,720,570 bp
  • A to T, chromosome 19 at 5,972,957 bp
  • T to A, chromosome 19 at 9,002,495 bp
  • A to T, chromosome 19 at 37,981,266 bp
  • A to T, chromosome 19 at 39,778,051 bp
  • T to G, chromosome 19 at 40,160,671 bp
  • T to A, chromosome 19 at 45,794,075 bp
  • G to T, chromosome 19 at 47,501,673 bp
  • G to T, chromosome 19 at 47,671,362 bp
  • T to A, chromosome X at 7,889,662 bp
  • T to C, chromosome X at 36,890,116 bp
  • T to A, chromosome X at 61,185,302 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0309 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038519-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.