Strain Name:
C57BL/6J-MtgxR0309Btlr/Mmmh
Stock Number:
038519-MU
Citation ID:
RRID:MMRRC_038519-MU
Other Names:
R0309 (G1), C57BL/6J-MtgxR0309Btlr
Major Collection:

Strain Information

Prrx1
Name: paired related homeobox 1
Synonyms: K-2, Prx1, mHox, Pmx1, mHox, A230024N07Rik, MHox1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18933
HGNC: HGNC:9142
Homologene: 7896
Pik3cd
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
Synonyms: p110delta, 2410099E07Rik, 2610208K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18707
HGNC: HGNC:8977
Homologene: 3686
Kdm4c
Name: lysine (K)-specific demethylase 4C
Synonyms: 2410141F18Rik, Jmjd2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 76804
Homologene: 41004
Nfib
Name: nuclear factor I/B
Synonyms: 6720429L07Rik, E030026I10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18028
HGNC: HGNC:7785
Homologene: 4087
Sgpl1
Name: sphingosine phosphate lyase 1
Synonyms: D10Xrf456
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 20397
Homologene: 2897
Map3k4
Name: mitogen-activated protein kinase kinase kinase 4
Synonyms: MTK1, MAPKKK4, D17Rp17, RP17, D17Rp17e, Mekk4, T-associated sex reversal, Tas
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 26407
VEGA: 17
HGNC: HGNC:6856
Homologene: 31346
B3gnt2
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Synonyms: B3Galt6, B3gnt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 53625
Homologene: 4797
Ptpn5
Name: protein tyrosine phosphatase, non-receptor type 5
Synonyms: Step
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19259
HGNC: HGNC:9657
Homologene: 8423
Slc4a2
Name: solute carrier family 4 (anion exchanger), member 2
Synonyms: B3RP, Ae2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20535
Homologene: 128699
Rc3h2
Name: ring finger and CCCH-type zinc finger domains 2
Synonyms: Rnf164, D930043C02Rik, 2900024N03Rik, 9430019J22Rik, Mnab
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 319817
Homologene: 28276
Pard3
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 93742
Homologene: 10489
Cep97
Name: centrosomal protein 97
Synonyms: 4932439K18Rik, E130116N02Rik, 2810403B08Rik, Lrriq2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74201
Homologene: 11579
Triobp
Name: TRIO and F-actin binding protein
Synonyms: Mus EST 478828, Tara, EST478828
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 110253
Homologene: 5104
Apbb2
Name: amyloid beta precursor protein binding family B member 2
Synonyms: TR2L, Rirl1, 2310007D03Rik, Zfra, FE65L1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 11787
HGNC: HGNC:582
Homologene: 32079
Dhx9
Name: DExH-box helicase 9
Synonyms: leukophysin, nuclear DNA helicase II, RNA helicase, Ddx9, NDH II, NDHII, RHA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13211
HGNC: HGNC:2750
Homologene: 1039
Xrcc5
Name: X-ray repair complementing defective repair in Chinese hamster cells 5
Synonyms: Ku80, Ku86
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22596
VEGA: 1
Homologene: 40681
Nup98
Name: nucleoporin 98
Synonyms: Nup96
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269966
HGNC: HGNC:8068
Homologene: 35472
Ago1
Name: argonaute RISC catalytic subunit 1
Synonyms: argonaute 1, Eif2c1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 236511
HGNC: HGNC:3262
Homologene: 81826
Sipa1l3
Name: signal-induced proliferation-associated 1 like 3
Synonyms: 2610511M17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74206
Homologene: 77938
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12316
Homologene: 7650
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19386
VEGA: 10
Homologene: 87808
Akap9
Name: A kinase anchor protein 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Fer
Name: FER tyrosine kinase
Synonyms: Fert, C330004K01Rik, Fert2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14158
VEGA: 17
HGNC: HGNC:3655
Homologene: 74300
Sin3a
Name: transcriptional regulator, SIN3A (yeast)
Synonyms: Sin3, mSin3A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20466
Homologene: 32124
Prrc2a
Name: proline-rich coiled-coil 2A
Synonyms: G2, Bat-2, D17H6S51E, Wbp12, 3110039B05Rik, Bat2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 53761
Homologene: 10567
Tbck
Name: TBC1 domain containing kinase
Synonyms: A630047E20Rik, C030007I09Rik, 1700120J03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 271981
Homologene: 13221
Glyr1
Name: glyoxylate reductase 1 homolog (Arabidopsis)
Synonyms: Npac, 2810419J22Rik, 3930401K13Rik, NDF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74022
VEGA: 16
Homologene: 12525
Sema4d
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D
Synonyms: semaphorin H, M-sema G, coll-4, CD100, Semcl2, Semaj, Semacl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20354
Homologene: 21282
Soat1
Name: sterol O-acyltransferase 1
Synonyms: ACAT-1, Acact, 8430426K15Rik, hid
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20652
Homologene: 2333
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 627872
Homologene: 41287
Kcnip2
Name: Kv channel-interacting protein 2
Synonyms: KChIP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 80906
Homologene: 23710
Ube3b
Name: ubiquitin protein ligase E3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 117146
Homologene: 13775
Pphln1
Name: periphilin 1
Synonyms: 1600022A19Rik, 1110063K05Rik, CR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223828
VEGA: 15
Homologene: 9533
Vps50
Name: VPS50 EARP/GARPII complex subunit
Synonyms: 8430415E05Rik, 1700034M03Rik, Ccdc132
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 73288
Homologene: 11498
Nmnat2
Name: nicotinamide nucleotide adenylyltransferase 2
Synonyms: PNAT1, D030041I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226518
Homologene: 75037
Pabpc1
Name: poly(A) binding protein, cytoplasmic 1
Synonyms: Pabpl1, Pabp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 18458
Homologene: 37638
Trpm4
Name: transient receptor potential cation channel, subfamily M, member 4
Synonyms: TRPM4B, 1110030C19Rik, LTRPC4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68667
Homologene: 23033
Tubb4a
Name: tubulin, beta 4A class IVA
Synonyms: Tubb, Tubb4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22153
VEGA: 17
Homologene: 55952
Zbtb18
Name: zinc finger and BTB domain containing 18
Synonyms: RP58, Zfp238
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 30928
Homologene: 21276
Nfix
Name: nuclear factor I/X
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18032
HGNC: HGNC:7788
Homologene: 1872
Angptl3
Name: angiopoietin-like 3
Synonyms: hypl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 30924
HGNC: HGNC:491
Homologene: 8499
Epgn
Name: epithelial mitogen
Synonyms: epigen, 2310069M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71920
Homologene: 19527
Calr
Name: calreticulin
Synonyms: CRT, Calregulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12317
HGNC: HGNC:1455
Homologene: 37911
Rab23
Name: RAB23, member RAS oncogene family
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19335
Homologene: 7503
Coq7
Name: demethyl-Q 7
Synonyms: clk-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12850
HGNC: HGNC:2244
Homologene: 6953
Clk1
Name: CDC-like kinase 1
Synonyms: STY, Clk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12747
HGNC: HGNC:2068
Homologene: 101535
Erc2
Name: ELKS/RAB6-interacting/CAST family member 2
Synonyms: D14Ertd171e, ELKS2alpha, CAST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 238988
Homologene: 69188
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, 2610100B16Rik, Odz3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 23965
Homologene: 22673
Cpq
Name: carboxypeptidase Q
Synonyms: HLS2, 1190003P12Rik, 2610034C17Rik, Lal-1, Pgcp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 54381
VEGA: 15
Homologene: 9401
Stn1
Name: STN1, CST complex subunit
Synonyms: 2310057J23Rik, 0610009H20Rik, Obfc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 108689
Homologene: 11788
Shq1
Name: SHQ1 homolog (S. cerevisiae)
Synonyms: 2810403P18Rik, Grim-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 72171
Homologene: 31683
Arhgap28
Name: Rho GTPase activating protein 28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268970
Homologene: 18264
Pnpla7
Name: patatin-like phospholipase domain containing 7
Synonyms: E430013P11Rik, NRE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241274
Homologene: 62431
Lemd3
Name: LEM domain containing 3
Synonyms: Man1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 380664
Homologene: 8633
Ank
Name: progressive ankylosis
Synonyms: D15Ertd221e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11732
Homologene: 10664
Il16
Name: interleukin 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16170
HGNC: HGNC:5980
Homologene: 18157
Ank1
Name: ankyrin 1, erythroid
Synonyms: Ank-1, pale
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11733
HGNC: HGNC:492
Homologene: 55427
Adamts13
Name: ADAM metallopeptidase with thrombospondin type 1 motif 13
Synonyms: vWF-CP mRNA for von Willebrand factor-cleaving, LOC279028
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 279028
HGNC: HGNC:1366
Homologene: 16372
Myof
Name: myoferlin
Synonyms: 2310051D19Rik, E030042N20Rik, Fer1l3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226101
VEGA: 19
HGNC: HGNC:3656
Homologene: 40882
Efcab2
Name: EF-hand calcium binding domain 2
Synonyms: D830011E08Rik, 1700073K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68226
Homologene: 12248
Tarbp1
Name: TAR RNA binding protein 1
Synonyms: Gm17296
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 212728
Homologene: 38082
Abcb4
Name: ATP-binding cassette, sub-family B member 4
Synonyms: mdr-2, Mdr2, Pgy-2, Pgy2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18670
HGNC: HGNC:45
Homologene: 136368
Dhx57
Name: DExH-box helicase 57
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106794
VEGA: 17
Homologene: 56267
Tent4a
Name: terminal nucleotidyltransferase 4A
Synonyms: LAK-1, TRF4, TRF4-1, Pols, Papd7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 210106
Homologene: 5089
Rapgef4
Name: Rap guanine nucleotide exchange factor (GEF) 4
Synonyms: Epac2, cAMP-GEFII, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 56508
Homologene: 4451
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Tas2r113
Name: taste receptor, type 2, member 113
Synonyms: Tas2r13, T2R13, mGR13, mt2r58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387345
Homologene: 130075
Hsh2d
Name: hematopoietic SH2 domain containing
Synonyms: ALX, Hsh2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 209488
Homologene: 13142
Zbtb41
Name: zinc finger and BTB domain containing 41
Synonyms: 8430415N23Rik, 9830132G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226470
Homologene: 27795
Ralgps1
Name: Ral GEF with PH domain and SH3 binding motif 1
Synonyms: RALGPS1A, RALGEF2, 5830418G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241308
Homologene: 65163
Cox6a2
Name: cytochrome c oxidase subunit 6A2
Synonyms: COXVIaH, VIaH, subunit VIaH (heart-type)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12862
HGNC: HGNC:2279
Homologene: 38020
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Mi-2 alpha, Prp9-1, Prp7, 2600010P09Rik, Chd7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Cyp2c70
Name: cytochrome P450, family 2, subfamily c, polypeptide 70
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226105
Homologene: 120027
Myh7b
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668940
Homologene: 66117
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Atp1a4
Name: ATPase, Na+/K+ transporting, alpha 4 polypeptide
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 27222
Homologene: 113769
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Npr2
Name: natriuretic peptide receptor 2
Synonyms: guanylyl cyclase-B, cn, pwe
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230103
HGNC: HGNC:7944
Homologene: 2970
Slc28a2b
Name: solute carrier family 28 member 2b
Synonyms: Gm14085
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381417
Chaf1b
Name: chromatin assembly factor 1, subunit B
Synonyms: 2600017H24Rik, MPHOSPH7, CAF-I 60 kDa subunit, CAF-1 subunit B, CAF-IP60, CAF1P60, CAF1A, CAF1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 110749
HGNC: HGNC:1911
Homologene: 48346
4930402F06Rik
Name: RIKEN cDNA 4930402F06 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74854
Homologene: 78017
Bpifb4
Name: BPI fold containing family B, member 4
Synonyms: LOC381399, Gm1006
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381399
Homologene: 66971
Or6c6c
Name: olfactory receptor family 6 subfamily C member 6C
Synonyms: GA_x6K02T2PULF-11383575-11384519, MOR110-7, Olfr804
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258068
Homologene: 133581
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 319807
Homologene: 14974
Slc2a7
Name: solute carrier family 2 (facilitated glucose transporter), member 7
Synonyms: OTTMUSG00000010396
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 435818
Homologene: 72470
Sntg2
Name: syntrophin, gamma 2
Synonyms: 2210008K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 268534
Homologene: 41298
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 76645
Homologene: 124481
Ppm1h
Name: protein phosphatase 1H (PP2C domain containing)
Synonyms: ARHCL1, A430075L18Rik, C030002B11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 319468
Homologene: 18537
Mylk
Name: myosin, light polypeptide kinase
Synonyms: telokin, Mlck, MLCK210, MLCK108, 9530072E15Rik, A930019C19Rik, nmMlck
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Kdr
Name: kinase insert domain protein receptor
Synonyms: VEGF receptor-2, VEGFR-2, VEGFR2, vascular endothelial growth factor receptor- 2, Flk-1, Flk1, orv
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 16542
HGNC: HGNC:6307
Homologene: 55639
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213452
Homologene: 19711
Or52s1
Name: olfactory receptor family 52 subfamily S member 1
Synonyms: GA_x6K02T2PBJ9-5927412-5928362, MOR24-2, Olfr593
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258378
Homologene: 27147
Prdm9
Name: PR domain containing 9
Synonyms: Meisetz, G1-419-29, repro7, Dsbc1, Rcr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 213389
Homologene: 104139
Unc5c
Name: unc-5 netrin receptor C
Synonyms: Unc5h3, B130051O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 22253
Homologene: 2765
Shisa9
Name: shisa family member 9
Synonyms: 2700045P11Rik, CKAMP44
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 72555
Homologene: 109462
Col17a1
Name: collagen, type XVII, alpha 1
Synonyms: BPAg2, BP180, Bpag, Bpag2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12821
HGNC: HGNC:2194
Homologene: 7276
Mpl
Name: myeloproliferative leukemia virus oncogene
Synonyms: c-mpl, thrombopoietin receptor, TPO-R, CD110, c-mpl-II, c-mpl-I, hlb219
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17480
HGNC: HGNC:7217
Homologene: 7845
Pcdhb12
Name: protocadherin beta 12
Synonyms: Pcdhb5F, PcdhbL, Pcdh3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93883
HGNC: HGNC:8690
Homologene: 87126
Cyp2c40
Name: cytochrome P450, family 2, subfamily c, polypeptide 40
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13099
Homologene: 74936
Gm9922
Name: predicted gene 9922
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 102633345
VEGA: 14
Gsta3
Name: glutathione S-transferase, alpha 3
Synonyms: Gst2-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14859
HGNC: HGNC:4628
Homologene: 37355
Ocstamp
Name: osteoclast stimulatory transmembrane protein
Synonyms: 4833422F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74614
Homologene: 41768
Ctso
Name: cathepsin O
Synonyms: A330105D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229445
HGNC: HGNC:2542
Homologene: 1020
Sgip1
Name: SH3-domain GRB2-like (endophilin) interacting protein 1
Synonyms: 3110007P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 73094
Homologene: 13001
Skint8
Name: selection and upkeep of intraepithelial T cells 8
Synonyms: OTTMUSG00000009475
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 639774
Homologene: 106613
Gm12830
Name: predicted gene 12830
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433746
Npffr2
Name: neuropeptide FF receptor 2
Synonyms: NPFF2, Gpr74
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 104443
HGNC: HGNC:4525
Homologene: 56982
Lancl2
Name: LanC (bacterial lantibiotic synthetase component C)-like 2
Synonyms: 1700003F10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 71835
HGNC: HGNC:6509
Homologene: 23116
Reg2
Name: regenerating islet-derived 2
Synonyms: pancreatic thread protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 19693
Homologene: 68517
Actg2
Name: actin, gamma 2, smooth muscle, enteric
Synonyms: SMGA, Act-4, Act4, Acta3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11468
HGNC: HGNC:145
Homologene: 123845
Vmn2r20
Name: vomeronasal 2, receptor 20
Synonyms: EG667180
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 667180
Homologene: 84037
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
Upf3a
Name: UPF3 regulator of nonsense transcripts homolog A (yeast)
Synonyms: 4930546M19Rik, RENT3A, UPF3, 2600001C03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67031
Homologene: 23395
Defa35
Name: defensin, alpha, 35
Synonyms: ENSMUSG00000061845, OTTMUSG00000018258, Gm10104
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100041688
Homologene: 113382
Calhm4
Name: calcium homeostasis modulator family member 4
Synonyms: LOC270711, 4732454E20Rik, Fam26d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 270711
VEGA: 10
Homologene: 19551
CT009546.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Txndc15
Name: thioredoxin domain containing 15
Synonyms: 2310047H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 69672
VEGA: 13
Homologene: 32594
Cntnap3
Name: contactin associated protein-like 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238680
VEGA: 13
Homologene: 129602
Klhl33
Name: kelch-like 33
Synonyms: EG546611
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 546611
VEGA: 14
Homologene: 52385
Ccdc188
Name: coiled-coil domain containing 188
Synonyms: Gm7873
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 102638083
VEGA: 16
Homologene: 90442
Cxadr
Name: coxsackie virus and adenovirus receptor
Synonyms: MCAR, 2610206D03Rik, CAR, MCVADR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13052
HGNC: HGNC:2559
Homologene: 1024
Zfp598
Name: zinc finger protein 598
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 213753
VEGA: 17
Homologene: 5672
Hmgxb3
Name: HMG box domain containing 3
Synonyms: 2510002C16Rik, A630042L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 106894
VEGA: 18
Homologene: 44229
Ehbp1l1
Name: EH domain binding protein 1-like 1
Synonyms: G430002G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 114601
VEGA: 19
Homologene: 136059
Slc22a20
Name: solute carrier family 22 (organic anion transporter), member 20
Synonyms: LOC381203, mOAT6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 381203
Homologene: 87203
Slc35a2
Name: solute carrier family 35 (UDP-galactose transporter), member A2
Synonyms: Sfc8, Had-1, Had1, Ugalt, UGT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 22232
Homologene: 38085
Nkrf
Name: NF-kappaB repressing factor
Synonyms: 9430034D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 77286
Homologene: 84816
Cdr1
Name: cerebellar degeneration related antigen 1
Synonyms: Cdr34, Gm7077, Gm2409
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 631990
VEGA: X
HGNC: HGNC:1798
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 21,264,894 bp
  • A to C, chromosome 1 at 33,734,861 bp
  • C to G, chromosome 1 at 53,405,690 bp
  • T to C, chromosome 1 at 58,413,033 bp
  • A to G, chromosome 1 at 72,307,576 bp
  • C to A, chromosome 1 at 132,456,864 bp
  • T to C, chromosome 1 at 139,438,984 bp
  • T to C, chromosome 1 at 139,482,511 bp
  • T to A, chromosome 1 at 153,077,001 bp
  • A to T, chromosome 1 at 153,465,695 bp
  • T to C, chromosome 1 at 156,442,453 bp
  • T to C, chromosome 1 at 163,312,559 bp
  • T to C, chromosome 1 at 172,234,987 bp
  • T to C, chromosome 1 at 177,448,616 bp
  • T to A, chromosome 1 at 178,475,904 bp
  • T to C, chromosome 2 at 24,987,195 bp
  • A to C, chromosome 2 at 26,986,989 bp
  • C to T, chromosome 2 at 33,157,923 bp
  • T to C, chromosome 2 at 35,376,259 bp
  • A to T, chromosome 2 at 37,379,008 bp
  • G to T, chromosome 2 at 72,226,030 bp
  • A to T, chromosome 2 at 122,517,553 bp
  • T to C, chromosome 2 at 153,959,683 bp
  • T to C, chromosome 2 at 155,630,672 bp
  • T to C, chromosome 2 at 165,395,992 bp
  • G to A, chromosome 3 at 81,944,861 bp
  • C to T, chromosome 3 at 132,734,407 bp
  • G to C, chromosome 3 at 141,733,933 bp
  • T to C, chromosome 4 at 43,640,904 bp
  • T to C, chromosome 4 at 74,345,567 bp
  • T to A, chromosome 4 at 82,296,737 bp
  • T to C, chromosome 4 at 99,034,469 bp
  • T to C, chromosome 4 at 102,915,157 bp
  • T to C, chromosome 4 at 111,938,867 bp
  • T to A, chromosome 4 at 114,844,976 bp
  • T to G, chromosome 4 at 118,446,038 bp
  • T to C, chromosome 4 at 126,443,166 bp
  • A to T, chromosome 4 at 149,663,220 bp
  • G to A, chromosome 4 at 150,158,071 bp
  • A to G, chromosome 5 at 4,069,038 bp
  • A to C, chromosome 5 at 8,939,835 bp
  • G to T, chromosome 5 at 24,434,346 bp
  • T to C, chromosome 5 at 63,807,218 bp
  • A to G, chromosome 5 at 66,310,988 bp
  • A to G, chromosome 5 at 75,946,927 bp
  • G to A, chromosome 5 at 89,583,347 bp
  • A to G, chromosome 5 at 91,032,214 bp
  • T to C, chromosome 5 at 114,419,469 bp
  • A to G, chromosome 6 at 3,536,853 bp
  • A to G, chromosome 6 at 57,703,132 bp
  • G to A, chromosome 6 at 78,406,186 bp
  • A to T, chromosome 6 at 83,519,914 bp
  • G to A, chromosome 6 at 100,573,627 bp
  • T to C, chromosome 6 at 123,386,104 bp
  • A to C, chromosome 6 at 132,893,378 bp
  • C to T, chromosome 7 at 29,348,350 bp
  • A to T, chromosome 7 at 43,694,345 bp
  • A to T, chromosome 7 at 45,308,706 bp
  • T to C, chromosome 7 at 47,079,294 bp
  • T to C, chromosome 7 at 83,722,554 bp
  • A to C, chromosome 7 at 102,152,428 bp
  • T to A, chromosome 7 at 103,212,721 bp
  • T to A, chromosome 7 at 118,529,717 bp
  • A to T, chromosome 7 at 128,205,935 bp
  • G to A, chromosome 8 at 13,795,500 bp
  • G to A, chromosome 8 at 21,065,855 bp
  • A to T, chromosome 8 at 23,104,809 bp
  • C to T, chromosome 8 at 48,341,034 bp
  • G to A, chromosome 8 at 72,200,460 bp
  • A to G, chromosome 8 at 84,721,774 bp
  • C to A, chromosome 8 at 84,843,031 bp
  • A to G, chromosome 8 at 116,997,576 bp
  • T to A, chromosome 8 at 126,438,928 bp
  • A to T, chromosome 8 at 127,376,897 bp
  • A to G, chromosome 9 at 57,110,912 bp
  • T to A, chromosome 9 at 79,600,011 bp
  • A to G, chromosome 10 at 34,044,047 bp
  • A to G, chromosome 10 at 58,479,868 bp
  • C to T, chromosome 10 at 61,113,437 bp
  • T to C, chromosome 10 at 120,937,110 bp
  • A to G, chromosome 10 at 122,920,782 bp
  • A to G, chromosome 10 at 129,705,139 bp
  • A to T, chromosome 11 at 22,836,860 bp
  • C to A, chromosome 11 at 66,026,972 bp
  • C to T, chromosome 11 at 69,357,018 bp
  • T to C, chromosome 12 at 30,226,773 bp
  • T to C, chromosome 13 at 13,965,667 bp
  • C to A, chromosome 13 at 51,725,311 bp
  • T to C, chromosome 13 at 55,724,582 bp
  • T to A, chromosome 13 at 64,757,436 bp
  • A to T, chromosome 13 at 69,499,932 bp
  • A to C, chromosome 14 at 28,141,225 bp
  • T to G, chromosome 14 at 50,891,411 bp
  • C to A, chromosome 14 at 101,729,693 bp
  • A to G, chromosome 15 at 27,567,572 bp
  • A to G, chromosome 15 at 33,594,151 bp
  • C to T, chromosome 15 at 36,597,493 bp
  • A to G, chromosome 15 at 78,976,540 bp
  • A to T, chromosome 15 at 93,441,707 bp
  • T to C, chromosome 16 at 5,031,972 bp
  • G to A, chromosome 16 at 11,997,123 bp
  • T to C, chromosome 16 at 18,219,305 bp
  • A to C, chromosome 16 at 34,912,297 bp
  • C to T, chromosome 16 at 55,925,058 bp
  • A to T, chromosome 16 at 78,334,948 bp
  • T to A, chromosome 16 at 93,884,511 bp
  • TGCTGGCTTCAGGGCCACAGTCCGCTG to TGCTG, chromosome 17 at 12,271,015 bp
  • G to A, chromosome 17 at 15,557,384 bp
  • T to C, chromosome 17 at 24,678,584 bp
  • A to G, chromosome 17 at 35,150,915 bp
  • G to T, chromosome 17 at 57,081,182 bp
  • A to G, chromosome 17 at 64,139,016 bp
  • A to T, chromosome 17 at 67,901,429 bp
  • A to G, chromosome 17 at 80,274,881 bp
  • G to T, chromosome 18 at 37,436,121 bp
  • G to A, chromosome 18 at 61,155,128 bp
  • T to C, chromosome 19 at 5,720,570 bp
  • A to T, chromosome 19 at 5,972,957 bp
  • T to A, chromosome 19 at 9,002,495 bp
  • A to T, chromosome 19 at 37,981,266 bp
  • A to T, chromosome 19 at 39,778,051 bp
  • T to G, chromosome 19 at 40,160,671 bp
  • T to A, chromosome 19 at 45,794,075 bp
  • G to T, chromosome 19 at 47,501,673 bp
  • G to T, chromosome 19 at 47,671,362 bp
  • T to A, chromosome X at 7,889,662 bp
  • T to C, chromosome X at 36,890,116 bp
  • T to A, chromosome X at 61,185,302 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0309 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038519-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.