Strain Name:
Stock Number:
Citation ID:
Other Names:
R0309 (G1), C57BL/6J-MtgxR0309Btlr
Major Collection:

Strain Information

Name: paired related homeobox 1
Synonyms: MHox1, mHox, Prx1, mHox, A230024N07Rik, K-2, Pmx1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18933
Homologene: 7896
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
Synonyms: p110delta, 2610208K16Rik, 2410099E07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18707
Homologene: 3686
Name: lysine (K)-specific demethylase 4C
Synonyms: 2410141F18Rik, Jmjd2c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76804
Homologene: 41004
Name: nuclear factor I/B
Synonyms: 6720429L07Rik, E030026I10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18028
Homologene: 4087
Name: sphingosine phosphate lyase 1
Synonyms: D10Xrf456
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20397
Homologene: 2897
Name: mitogen-activated protein kinase kinase kinase 4
Synonyms: D17Rp17e, Tas, MAPKKK4, D17Rp17, Mekk4, RP17, T-associated sex reversal, MTK1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26407
VEGA: 17
Homologene: 31346
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Synonyms: B3gnt1, B3Galt6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53625
Homologene: 4797
Name: protein tyrosine phosphatase, non-receptor type 5
Synonyms: Step
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19259
Homologene: 8423
Name: solute carrier family 4 (anion exchanger), member 2
Synonyms: Ae2, B3RP
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20535
Homologene: 128699
Name: ring finger and CCCH-type zinc finger domains 2
Synonyms: Mnab, 2900024N03Rik, D930043C02Rik, Rnf164, 9430019J22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319817
Homologene: 28276
Name: par-3 family cell polarity regulator
Synonyms: PAR-3, Par3, Pard3a, D8Ertd580e, ASIP
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93742
Homologene: 10489
Name: centrosomal protein 97
Synonyms: 4932439K18Rik, Lrriq2, E130116N02Rik, 2810403B08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74201
Homologene: 11579
Name: TRIO and F-actin binding protein
Synonyms: EST478828, Tara, Mus EST 478828
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110253
Homologene: 5104
Name: amyloid beta precursor protein binding family B member 2
Synonyms: Zfra, Rirl1, FE65L1, 2310007D03Rik, TR2L
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11787
Homologene: 32079
Name: DExH-box helicase 9
Synonyms: leukophysin, Ddx9, RHA, NDHII, NDH II, nuclear DNA helicase II, RNA helicase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13211
Homologene: 1039
Name: X-ray repair complementing defective repair in Chinese hamster cells 5
Synonyms: Ku86, Ku80
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22596
Homologene: 40681
Name: nucleoporin 98
Synonyms: Nup96
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269966
Homologene: 35472
Name: argonaute RISC catalytic subunit 1
Synonyms: Eif2c1, argonaute 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 236511
Homologene: 81826
Name: signal-induced proliferation-associated 1 like 3
Synonyms: 2610511M17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74206
Homologene: 77938
Name: abnormal spindle microtubule assembly
Synonyms: Calmbp1, Sha1, D330028K02Rik, Aspm, MCPH5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19386
VEGA: 10
Homologene: 87808
Name: A kinase anchor protein 9
Synonyms: G1-448-15, 5730481H23Rik, mei2-5, AKAP450, repro12
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100986
Homologene: 134583
Name: FER tyrosine kinase
Synonyms: Fert2, C330004K01Rik, Fert
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14158
VEGA: 17
Homologene: 74300
Name: transcriptional regulator, SIN3A (yeast)
Synonyms: mSin3A, Sin3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20466
Homologene: 32124
Name: proline-rich coiled-coil 2A
Synonyms: D17H6S51E, Bat2, Bat-2, G2, Wbp12, 3110039B05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 53761
Homologene: 10567
Name: TBC1 domain containing kinase
Synonyms: A630047E20Rik, C030007I09Rik, 1700120J03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 271981
Homologene: 13221
Name: glyoxylate reductase 1 homolog (Arabidopsis)
Synonyms: 3930401K13Rik, 2810419J22Rik, NDF, Npac
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74022
VEGA: 16
Homologene: 12525
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D
Synonyms: semaphorin H, Semcl2, Semaj, Semacl2, CD100, coll-4, M-sema G
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20354
Homologene: 21282
Name: sterol O-acyltransferase 1
Synonyms: ACAT-1, hid, Acact, 8430426K15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20652
Homologene: 2333
Name: dynein, axonemal, heavy chain 7A
Synonyms: Dnahc7a, LOC381341, Dnahc7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Name: Kv channel-interacting protein 2
Synonyms: KChIP2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 80906
Homologene: 23710
Name: ubiquitin protein ligase E3B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117146
Homologene: 13775
Name: periphilin 1
Synonyms: CR, 1600022A19Rik, 1110063K05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223828
VEGA: 15
Homologene: 9533
Name: VPS50 EARP/GARPII complex subunit
Synonyms: Ccdc132, 8430415E05Rik, 1700034M03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73288
Homologene: 11498
Name: nicotinamide nucleotide adenylyltransferase 2
Synonyms: PNAT1, D030041I09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226518
Homologene: 75037
Name: poly(A) binding protein, cytoplasmic 1
Synonyms: Pabpl1, Pabp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18458
Homologene: 37638
Name: transient receptor potential cation channel, subfamily M, member 4
Synonyms: LTRPC4, 1110030C19Rik, TRPM4B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68667
Homologene: 23033
Name: tubulin, beta 4A class IVA
Synonyms: Tubb4, Tubb
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22153
VEGA: 17
Homologene: 55952
Name: zinc finger and BTB domain containing 18
Synonyms: RP58, Zfp238
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 30928
Homologene: 21276
Name: nuclear factor I/X
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18032
Homologene: 1872
Name: angiopoietin-like 3
Synonyms: hypl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30924
Homologene: 8499
Name: epithelial mitogen
Synonyms: epigen, 2310069M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71920
Homologene: 19527
Name: calreticulin
Synonyms: CRT, Calregulin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12317
Homologene: 37911
Name: RAB23, member RAS oncogene family
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19335
Homologene: 7503
Name: demethyl-Q 7
Synonyms: clk-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12850
Homologene: 6953
Name: CDC-like kinase 1
Synonyms: Clk1, STY
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12747
Homologene: 101535
Name: ELKS/RAB6-interacting/CAST family member 2
Synonyms: ELKS2alpha, CAST, D14Ertd171e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 238988
Homologene: 69188
Name: teneurin transmembrane protein 3
Synonyms: Odz3, 2610100B16Rik, Ten-m3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Name: carboxypeptidase Q
Synonyms: 2610034C17Rik, Lal-1, HLS2, Pgcp, 1190003P12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54381
VEGA: 15
Homologene: 9401
Name: STN1, CST complex subunit
Synonyms: Obfc1, 2310057J23Rik, 0610009H20Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 108689
Homologene: 11788
Name: SHQ1 homolog (S. cerevisiae)
Synonyms: Grim-1, 2810403P18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72171
Homologene: 31683
Name: Rho GTPase activating protein 28
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268970
Homologene: 18264
Name: patatin-like phospholipase domain containing 7
Synonyms: NRE, E430013P11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241274
Homologene: 62431
Name: LEM domain containing 3
Synonyms: Man1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380664
Homologene: 8633
Name: progressive ankylosis
Synonyms: D15Ertd221e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11732
Homologene: 10664
Name: interleukin 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16170
Homologene: 18157
Name: ankyrin 1, erythroid
Synonyms: pale, Ank-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11733
Homologene: 55427
Name: ADAM metallopeptidase with thrombospondin type 1 motif 13
Synonyms: vWF-CP mRNA for von Willebrand factor-cleaving, LOC279028
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 279028
Homologene: 16372
Name: myoferlin
Synonyms: Fer1l3, E030042N20Rik, 2310051D19Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226101
VEGA: 19
Homologene: 40882
Name: EF-hand calcium binding domain 2
Synonyms: 1700073K01Rik, D830011E08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68226
Homologene: 12248
Name: TAR RNA binding protein 1
Synonyms: Gm17296
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212728
Homologene: 38082
Name: ATP-binding cassette, sub-family B member 4
Synonyms: mdr-2, Pgy-2, Mdr2, Pgy2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18670
Homologene: 136368
Name: DExH-box helicase 57
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106794
VEGA: 17
Homologene: 56267
Name: terminal nucleotidyltransferase 4A
Synonyms: LAK-1, Papd7, TRF4-1, TRF4, Pols
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210106
Homologene: 5089
Name: Rap guanine nucleotide exchange factor (GEF) 4
Synonyms: Epac2, 5730402K07Rik, 1300003D15Rik, cAMP-GEFII, 6330581N18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56508
Homologene: 4451
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12816
Homologene: 3217
Name: taste receptor, type 2, member 113
Synonyms: Tas2r13, mGR13, mt2r58, T2R13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387345
Homologene: 130075
Name: hematopoietic SH2 domain containing
Synonyms: Hsh2, ALX
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 209488
Homologene: 13142
Name: zinc finger and BTB domain containing 41
Synonyms: 8430415N23Rik, 9830132G07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226470
Homologene: 27795
Name: Ral GEF with PH domain and SH3 binding motif 1
Synonyms: 5830418G11Rik, RALGPS1A, RALGEF2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241308
Homologene: 65163
Name: cytochrome c oxidase subunit 6A2
Synonyms: subunit VIaH (heart-type), COXVIaH, VIaH
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12862
Homologene: 38020
Name: chromodomain helicase DNA binding protein 3
Synonyms: Chd7, 2600010P09Rik, Mi-2 alpha, Prp7, Prp9-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
Homologene: 62693
Name: cytochrome P450, family 2, subfamily c, polypeptide 70
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226105
Homologene: 120027
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668940
Homologene: 66117
Name: dynein, axonemal, heavy chain 9
Synonyms: Dnahc9, D11Ertd686e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
Homologene: 20357
Name: ATPase, Na+/K+ transporting, alpha 4 polypeptide
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27222
Homologene: 113769
Name: AHNAK nucleoprotein
Synonyms: 2310047C17Rik, 1110004P15Rik, DY6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
Homologene: 67425
Name: natriuretic peptide receptor 2
Synonyms: pwe, cn, guanylyl cyclase-B
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230103
Homologene: 2970
Name: solute carrier family 28 member 2b
Synonyms: Gm14085
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381417
Name: chromatin assembly factor 1, subunit B
Synonyms: CAF-I 60 kDa subunit, CAF-IP60, CAF1P60, CAF1A, CAF1, 2600017H24Rik, MPHOSPH7, CAF-1 subunit B
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110749
Homologene: 48346
Name: RIKEN cDNA 4930402F06 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74854
Homologene: 78017
Name: BPI fold containing family B, member 4
Synonyms: LOC381399, Gm1006
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381399
Homologene: 66971
Name: olfactory receptor family 6 subfamily C member 6C
Synonyms: Olfr804, GA_x6K02T2PULF-11383575-11384519, MOR110-7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258068
Homologene: 133581
Name: NACHT and WD repeat domain containing 2
Synonyms: 3110047P20Rik, B830017A01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319807
Homologene: 14974
Name: solute carrier family 2 (facilitated glucose transporter), member 7
Synonyms: OTTMUSG00000010396
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435818
Homologene: 72470
Name: syntrophin, gamma 2
Synonyms: 2210008K22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268534
Homologene: 41298
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76645
Homologene: 124481
Name: protein phosphatase 1H (PP2C domain containing)
Synonyms: C030002B11Rik, A430075L18Rik, ARHCL1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319468
Homologene: 18537
Name: myosin, light polypeptide kinase
Synonyms: Mlck, telokin, MLCK210, MLCK108, nmMlck, A930019C19Rik, 9530072E15Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 107589
Homologene: 14202
Name: kinase insert domain protein receptor
Synonyms: Flk1, orv, VEGFR-2, Flk-1, VEGF receptor-2, VEGFR2, vascular endothelial growth factor receptor- 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16542
Homologene: 55639
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: C430014H23Rik, A930019K20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213452
Homologene: 19711
Name: olfactory receptor family 52 subfamily S member 1
Synonyms: Olfr593, GA_x6K02T2PBJ9-5927412-5928362, MOR24-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258378
Homologene: 27147
Name: PR domain containing 9
Synonyms: Meisetz, G1-419-29, repro7, Rcr1, Dsbc1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213389
Homologene: 104139
Name: unc-5 netrin receptor C
Synonyms: Unc5h3, B130051O18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22253
Homologene: 2765
Name: shisa family member 9
Synonyms: CKAMP44, 2700045P11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72555
Homologene: 109462
Name: collagen, type XVII, alpha 1
Synonyms: Bpag2, Bpag, BP180, BPAg2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12821
Homologene: 7276
Name: myeloproliferative leukemia virus oncogene
Synonyms: TPO-R, c-mpl-I, hlb219, c-mpl, c-mpl-II, CD110, thrombopoietin receptor
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17480
Homologene: 7845
Name: protocadherin beta 12
Synonyms: Pcdh3, PcdhbL, Pcdhb5F
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93883
Homologene: 87126
Name: cytochrome P450, family 2, subfamily c, polypeptide 40
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13099
Homologene: 74936
Name: predicted gene 9922
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 102633345
VEGA: 14
Name: glutathione S-transferase, alpha 3
Synonyms: Gst2-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14859
Homologene: 37355
Name: osteoclast stimulatory transmembrane protein
Synonyms: 4833422F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74614
Homologene: 41768
Name: cathepsin O
Synonyms: A330105D01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229445
Homologene: 1020
Name: SH3-domain GRB2-like (endophilin) interacting protein 1
Synonyms: 3110007P09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73094
Homologene: 13001
Name: selection and upkeep of intraepithelial T cells 8
Synonyms: OTTMUSG00000009475
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 639774
Homologene: 106613
Name: predicted gene 12830
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433746
Name: neuropeptide FF receptor 2
Synonyms: NPFF2, Gpr74
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 104443
Homologene: 56982
Name: LanC (bacterial lantibiotic synthetase component C)-like 2
Synonyms: 1700003F10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71835
Homologene: 23116
Name: regenerating islet-derived 2
Synonyms: pancreatic thread protein
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19693
Homologene: 68517
Name: actin, gamma 2, smooth muscle, enteric
Synonyms: SMGA, Acta3, Act-4, Act4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11468
Homologene: 123845
Name: vomeronasal 2, receptor 20
Synonyms: EG667180
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 667180
Homologene: 84037
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317653
Homologene: 69348
Name: UPF3 regulator of nonsense transcripts homolog A (yeast)
Synonyms: 4930546M19Rik, RENT3A, UPF3, 2600001C03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67031
Homologene: 23395
Name: defensin, alpha, 35
Synonyms: OTTMUSG00000018258, ENSMUSG00000061845, Gm10104
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100041688
Homologene: 113382
Name: calcium homeostasis modulator family member 4
Synonyms: Fam26d, LOC270711, 4732454E20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270711
VEGA: 10
Homologene: 19551
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Name: thioredoxin domain containing 15
Synonyms: 2310047H23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69672
VEGA: 13
Homologene: 32594
Name: contactin associated protein-like 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238680
VEGA: 13
Homologene: 129602
Name: kelch-like 33
Synonyms: EG546611
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 546611
VEGA: 14
Homologene: 52385
Name: coiled-coil domain containing 188
Synonyms: Gm7873
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 102638083
VEGA: 16
Homologene: 90442
Name: coxsackie virus and adenovirus receptor
Synonyms: MCAR, 2610206D03Rik, MCVADR, CAR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13052
Homologene: 1024
Name: zinc finger protein 598
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213753
VEGA: 17
Homologene: 5672
Name: HMG box domain containing 3
Synonyms: A630042L21Rik, 2510002C16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106894
VEGA: 18
Homologene: 44229
Name: EH domain binding protein 1-like 1
Synonyms: G430002G23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 114601
VEGA: 19
Homologene: 136059
Name: solute carrier family 22 (organic anion transporter), member 20
Synonyms: mOAT6, LOC381203
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381203
Homologene: 87203
Name: solute carrier family 35 (UDP-galactose transporter), member A2
Synonyms: UGT, Had-1, Ugalt, Had1, Sfc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 22232
Homologene: 38085
Name: NF-kappaB repressing factor
Synonyms: 9430034D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 77286
Homologene: 84816
Name: cerebellar degeneration related antigen 1
Synonyms: Gm7077, Gm2409, Cdr34
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 631990
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 21,264,894 bp
  • A to C, chromosome 1 at 33,734,861 bp
  • C to G, chromosome 1 at 53,405,690 bp
  • T to C, chromosome 1 at 58,413,033 bp
  • A to G, chromosome 1 at 72,307,576 bp
  • C to A, chromosome 1 at 132,456,864 bp
  • T to C, chromosome 1 at 139,438,984 bp
  • T to C, chromosome 1 at 139,482,511 bp
  • T to A, chromosome 1 at 153,077,001 bp
  • A to T, chromosome 1 at 153,465,695 bp
  • T to C, chromosome 1 at 156,442,453 bp
  • T to C, chromosome 1 at 163,312,559 bp
  • T to C, chromosome 1 at 172,234,987 bp
  • T to C, chromosome 1 at 177,448,616 bp
  • T to A, chromosome 1 at 178,475,904 bp
  • T to C, chromosome 2 at 24,987,195 bp
  • A to C, chromosome 2 at 26,986,989 bp
  • C to T, chromosome 2 at 33,157,923 bp
  • T to C, chromosome 2 at 35,376,259 bp
  • A to T, chromosome 2 at 37,379,008 bp
  • G to T, chromosome 2 at 72,226,030 bp
  • A to T, chromosome 2 at 122,517,553 bp
  • T to C, chromosome 2 at 153,959,683 bp
  • T to C, chromosome 2 at 155,630,672 bp
  • T to C, chromosome 2 at 165,395,992 bp
  • G to A, chromosome 3 at 81,944,861 bp
  • C to T, chromosome 3 at 132,734,407 bp
  • G to C, chromosome 3 at 141,733,933 bp
  • T to C, chromosome 4 at 43,640,904 bp
  • T to C, chromosome 4 at 74,345,567 bp
  • T to A, chromosome 4 at 82,296,737 bp
  • T to C, chromosome 4 at 99,034,469 bp
  • T to C, chromosome 4 at 102,915,157 bp
  • T to C, chromosome 4 at 111,938,867 bp
  • T to A, chromosome 4 at 114,844,976 bp
  • T to G, chromosome 4 at 118,446,038 bp
  • T to C, chromosome 4 at 126,443,166 bp
  • A to T, chromosome 4 at 149,663,220 bp
  • G to A, chromosome 4 at 150,158,071 bp
  • A to G, chromosome 5 at 4,069,038 bp
  • A to C, chromosome 5 at 8,939,835 bp
  • G to T, chromosome 5 at 24,434,346 bp
  • T to C, chromosome 5 at 63,807,218 bp
  • A to G, chromosome 5 at 66,310,988 bp
  • A to G, chromosome 5 at 75,946,927 bp
  • G to A, chromosome 5 at 89,583,347 bp
  • A to G, chromosome 5 at 91,032,214 bp
  • T to C, chromosome 5 at 114,419,469 bp
  • A to G, chromosome 6 at 3,536,853 bp
  • A to G, chromosome 6 at 57,703,132 bp
  • G to A, chromosome 6 at 78,406,186 bp
  • A to T, chromosome 6 at 83,519,914 bp
  • G to A, chromosome 6 at 100,573,627 bp
  • T to C, chromosome 6 at 123,386,104 bp
  • A to C, chromosome 6 at 132,893,378 bp
  • C to T, chromosome 7 at 29,348,350 bp
  • A to T, chromosome 7 at 43,694,345 bp
  • A to T, chromosome 7 at 45,308,706 bp
  • T to C, chromosome 7 at 47,079,294 bp
  • T to C, chromosome 7 at 83,722,554 bp
  • A to C, chromosome 7 at 102,152,428 bp
  • T to A, chromosome 7 at 103,212,721 bp
  • T to A, chromosome 7 at 118,529,717 bp
  • A to T, chromosome 7 at 128,205,935 bp
  • G to A, chromosome 8 at 13,795,500 bp
  • G to A, chromosome 8 at 21,065,855 bp
  • A to T, chromosome 8 at 23,104,809 bp
  • C to T, chromosome 8 at 48,341,034 bp
  • G to A, chromosome 8 at 72,200,460 bp
  • A to G, chromosome 8 at 84,721,774 bp
  • C to A, chromosome 8 at 84,843,031 bp
  • A to G, chromosome 8 at 116,997,576 bp
  • T to A, chromosome 8 at 126,438,928 bp
  • A to T, chromosome 8 at 127,376,897 bp
  • A to G, chromosome 9 at 57,110,912 bp
  • T to A, chromosome 9 at 79,600,011 bp
  • A to G, chromosome 10 at 34,044,047 bp
  • A to G, chromosome 10 at 58,479,868 bp
  • C to T, chromosome 10 at 61,113,437 bp
  • T to C, chromosome 10 at 120,937,110 bp
  • A to G, chromosome 10 at 122,920,782 bp
  • A to G, chromosome 10 at 129,705,139 bp
  • A to T, chromosome 11 at 22,836,860 bp
  • C to A, chromosome 11 at 66,026,972 bp
  • C to T, chromosome 11 at 69,357,018 bp
  • T to C, chromosome 12 at 30,226,773 bp
  • T to C, chromosome 13 at 13,965,667 bp
  • C to A, chromosome 13 at 51,725,311 bp
  • T to C, chromosome 13 at 55,724,582 bp
  • T to A, chromosome 13 at 64,757,436 bp
  • A to T, chromosome 13 at 69,499,932 bp
  • A to C, chromosome 14 at 28,141,225 bp
  • T to G, chromosome 14 at 50,891,411 bp
  • C to A, chromosome 14 at 101,729,693 bp
  • A to G, chromosome 15 at 27,567,572 bp
  • A to G, chromosome 15 at 33,594,151 bp
  • C to T, chromosome 15 at 36,597,493 bp
  • A to G, chromosome 15 at 78,976,540 bp
  • A to T, chromosome 15 at 93,441,707 bp
  • T to C, chromosome 16 at 5,031,972 bp
  • G to A, chromosome 16 at 11,997,123 bp
  • T to C, chromosome 16 at 18,219,305 bp
  • A to C, chromosome 16 at 34,912,297 bp
  • C to T, chromosome 16 at 55,925,058 bp
  • A to T, chromosome 16 at 78,334,948 bp
  • T to A, chromosome 16 at 93,884,511 bp
  • TGCTGGCTTCAGGGCCACAGTCCGCTG to TGCTG, chromosome 17 at 12,271,015 bp
  • G to A, chromosome 17 at 15,557,384 bp
  • T to C, chromosome 17 at 24,678,584 bp
  • A to G, chromosome 17 at 35,150,915 bp
  • G to T, chromosome 17 at 57,081,182 bp
  • A to G, chromosome 17 at 64,139,016 bp
  • A to T, chromosome 17 at 67,901,429 bp
  • A to G, chromosome 17 at 80,274,881 bp
  • G to T, chromosome 18 at 37,436,121 bp
  • G to A, chromosome 18 at 61,155,128 bp
  • T to C, chromosome 19 at 5,720,570 bp
  • A to T, chromosome 19 at 5,972,957 bp
  • T to A, chromosome 19 at 9,002,495 bp
  • A to T, chromosome 19 at 37,981,266 bp
  • A to T, chromosome 19 at 39,778,051 bp
  • T to G, chromosome 19 at 40,160,671 bp
  • T to A, chromosome 19 at 45,794,075 bp
  • G to T, chromosome 19 at 47,501,673 bp
  • G to T, chromosome 19 at 47,671,362 bp
  • T to A, chromosome X at 7,889,662 bp
  • T to C, chromosome X at 36,890,116 bp
  • T to A, chromosome X at 61,185,302 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0309 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038519-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.