Strain Name:
Stock Number:
Citation ID:
Other Names:
R0309 (G1), C57BL/6J-MtgxR0309Btlr
Major Collection:

Strain Information

Name: paired related homeobox 1
Synonyms: K-2, Prx1, mHox, Pmx1, mHox, A230024N07Rik, MHox1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18933
Homologene: 7896
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
Synonyms: p110delta, 2410099E07Rik, 2610208K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18707
Homologene: 3686
Name: lysine (K)-specific demethylase 4C
Synonyms: 2410141F18Rik, Jmjd2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 76804
Homologene: 41004
Name: nuclear factor I/B
Synonyms: 6720429L07Rik, E030026I10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18028
Homologene: 4087
Name: sphingosine phosphate lyase 1
Synonyms: D10Xrf456
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 20397
Homologene: 2897
Name: mitogen-activated protein kinase kinase kinase 4
Synonyms: MTK1, MAPKKK4, D17Rp17, RP17, D17Rp17e, Mekk4, T-associated sex reversal, Tas
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 26407
VEGA: 17
Homologene: 31346
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Synonyms: B3Galt6, B3gnt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 53625
Homologene: 4797
Name: protein tyrosine phosphatase, non-receptor type 5
Synonyms: Step
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19259
Homologene: 8423
Name: solute carrier family 4 (anion exchanger), member 2
Synonyms: B3RP, Ae2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20535
Homologene: 128699
Name: ring finger and CCCH-type zinc finger domains 2
Synonyms: Rnf164, D930043C02Rik, 2900024N03Rik, 9430019J22Rik, Mnab
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 319817
Homologene: 28276
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 93742
Homologene: 10489
Name: centrosomal protein 97
Synonyms: 4932439K18Rik, E130116N02Rik, 2810403B08Rik, Lrriq2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74201
Homologene: 11579
Name: TRIO and F-actin binding protein
Synonyms: Mus EST 478828, Tara, EST478828
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 110253
Homologene: 5104
Name: amyloid beta (A4) precursor protein-binding, family B, member 2
Synonyms: TR2L, Rirl1, 2310007D03Rik, Zfra, FE65L1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 11787
Homologene: 32079
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 9
Synonyms: leukophysin, nuclear DNA helicase II, RNA helicase, Ddx9, NDH II, NDHII, RHA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13211
Homologene: 1039
Name: X-ray repair complementing defective repair in Chinese hamster cells 5
Synonyms: Ku80, Ku86
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22596
Homologene: 40681
Name: nucleoporin 98
Synonyms: Nup96
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269966
Homologene: 35472
Name: argonaute RISC catalytic subunit 1
Synonyms: argonaute 1, Eif2c1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 236511
Homologene: 81826
Name: signal-induced proliferation-associated 1 like 3
Synonyms: 2610511M17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74206
Homologene: 77938
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12316
Homologene: 7650
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19386
VEGA: 10
Homologene: 87808
Name: A kinase (PRKA) anchor protein (yotiao) 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100986
Homologene: 134583
Name: fer (fms/fps related) protein kinase
Synonyms: Fert, C330004K01Rik, Fert2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14158
VEGA: 17
Homologene: 74300
Name: transcriptional regulator, SIN3A (yeast)
Synonyms: Sin3, mSin3A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20466
Homologene: 32124
Name: proline-rich coiled-coil 2A
Synonyms: G2, Bat-2, D17H6S51E, Wbp12, 3110039B05Rik, Bat2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 53761
Homologene: 10567
Name: TBC1 domain containing kinase
Synonyms: A630047E20Rik, C030007I09Rik, 1700120J03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 271981
Homologene: 13221
Name: glyoxylate reductase 1 homolog (Arabidopsis)
Synonyms: Npac, 2810419J22Rik, 3930401K13Rik, NDF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74022
VEGA: 16
Homologene: 12525
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D
Synonyms: semaphorin H, M-sema G, coll-4, CD100, Semcl2, Semaj, Semacl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20354
Homologene: 21282
Name: sterol O-acyltransferase 1
Synonyms: ACAT-1, Acact, 8430426K15Rik, hid
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20652
Homologene: 2333
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 627872
Homologene: 41287
Name: Kv channel-interacting protein 2
Synonyms: KChIP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 80906
Homologene: 23710
Name: ubiquitin protein ligase E3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 117146
Homologene: 13775
Name: periphilin 1
Synonyms: 1600022A19Rik, 1110063K05Rik, CR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223828
VEGA: 15
Homologene: 9533
Name: VPS50 EARP/GARPII complex subunit
Synonyms: 8430415E05Rik, 1700034M03Rik, Ccdc132
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 73288
Homologene: 11498
Name: nicotinamide nucleotide adenylyltransferase 2
Synonyms: PNAT1, D030041I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226518
Homologene: 75037
Name: poly(A) binding protein, cytoplasmic 1
Synonyms: Pabpl1, Pabp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 18458
Homologene: 37638
Name: transient receptor potential cation channel, subfamily M, member 4
Synonyms: TRPM4B, 1110030C19Rik, LTRPC4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68667
Homologene: 23033
Name: tubulin, beta 4A class IVA
Synonyms: Tubb, Tubb4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22153
VEGA: 17
Homologene: 55952
Name: zinc finger and BTB domain containing 18
Synonyms: RP58, Zfp238
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 30928
Homologene: 21276
Name: nuclear factor I/X
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18032
Homologene: 1872
Name: angiopoietin-like 3
Synonyms: hypl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 30924
Homologene: 8499
Name: epithelial mitogen
Synonyms: epigen, 2310069M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71920
Homologene: 19527
Name: calreticulin
Synonyms: CRT, Calregulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12317
Homologene: 37911
Name: RAB23, member RAS oncogene family
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19335
Homologene: 7503
Name: demethyl-Q 7
Synonyms: clk-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12850
Homologene: 6953
Name: CDC-like kinase 1
Synonyms: STY, Clk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12747
Homologene: 101535
Name: ELKS/RAB6-interacting/CAST family member 2
Synonyms: D14Ertd171e, ELKS2alpha, CAST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 238988
Homologene: 69188
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, 2610100B16Rik, Odz3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 23965
Homologene: 22673
Name: carboxypeptidase Q
Synonyms: HLS2, 1190003P12Rik, 2610034C17Rik, Lal-1, Pgcp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 54381
VEGA: 15
Homologene: 9401
Name: STN1, CST complex subunit
Synonyms: 2310057J23Rik, 0610009H20Rik, Obfc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 108689
Homologene: 11788
Name: SHQ1 homolog (S. cerevisiae)
Synonyms: 2810403P18Rik, Grim-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 72171
Homologene: 31683
Name: Rho GTPase activating protein 28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268970
Homologene: 18264
Name: patatin-like phospholipase domain containing 7
Synonyms: E430013P11Rik, NRE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241274
Homologene: 62431
Name: LEM domain containing 3
Synonyms: Man1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 380664
Homologene: 8633
Name: progressive ankylosis
Synonyms: D15Ertd221e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11732
Homologene: 10664
Name: interleukin 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16170
Homologene: 18157
Name: ankyrin 1, erythroid
Synonyms: Ank-1, pale
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11733
Homologene: 55427
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13
Synonyms: LOC279028, vWF-CP mRNA for von Willebrand factor-cleaving
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 279028
Homologene: 16372
Name: myoferlin
Synonyms: 2310051D19Rik, E030042N20Rik, Fer1l3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226101
VEGA: 19
Homologene: 40882
Name: EF-hand calcium binding domain 2
Synonyms: D830011E08Rik, 1700073K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68226
Homologene: 12248
Name: TAR RNA binding protein 1
Synonyms: Gm17296
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 212728
Homologene: 38082
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 4
Synonyms: mdr-2, Mdr2, Pgy-2, Pgy2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18670
Homologene: 136368
Name: DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106794
VEGA: 17
Homologene: 56267
Name: terminal nucleotidyltransferase 4A
Synonyms: LAK-1, TRF4, TRF4-1, Pols, Papd7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 210106
Homologene: 5089
Name: Rap guanine nucleotide exchange factor (GEF) 4
Synonyms: 1300003D15Rik, Epac2, cAMP-GEFII, 5730402K07Rik, 6330581N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 56508
Homologene: 4451
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12816
Homologene: 3217
Name: taste receptor, type 2, member 113
Synonyms: Tas2r13, T2R13, mGR13, mt2r58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387345
Homologene: 130075
Name: hematopoietic SH2 domain containing
Synonyms: ALX, Hsh2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 209488
Homologene: 13142
Name: zinc finger and BTB domain containing 41
Synonyms: 8430415N23Rik, 9830132G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226470
Homologene: 27795
Name: Ral GEF with PH domain and SH3 binding motif 1
Synonyms: RALGPS1A, RALGEF2, 5830418G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241308
Homologene: 65163
Name: cytochrome c oxidase subunit 6A2
Synonyms: COXVIaH, VIaH, subunit VIaH (heart-type)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12862
Homologene: 38020
Name: chromodomain helicase DNA binding protein 3
Synonyms: Mi-2 alpha, Prp9-1, Prp7, 2600010P09Rik, Chd7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216848
Homologene: 62693
Name: cytochrome P450, family 2, subfamily c, polypeptide 70
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226105
Homologene: 120027
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668940
Homologene: 66117
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237806
Homologene: 20357
Name: ATPase, Na+/K+ transporting, alpha 4 polypeptide
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 27222
Homologene: 113769
Name: AHNAK nucleoprotein (desmoyokin)
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66395
VEGA: 19
Homologene: 67425
Name: natriuretic peptide receptor 2
Synonyms: guanylyl cyclase-B, cn, pwe
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230103
Homologene: 2970
Name: solute carrier family 28 member 2b
Synonyms: Gm14085
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381417
Name: chromatin assembly factor 1, subunit B (p60)
Synonyms: 2600017H24Rik, MPHOSPH7, CAF-I 60 kDa subunit, CAF-1 subunit B, CAF-IP60, CAF1P60, CAF1A, CAF1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 110749
Homologene: 48346
Name: RIKEN cDNA 4930402F06 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74854
Homologene: 78017
Name: BPI fold containing family B, member 4
Synonyms: LOC381399, Gm1006
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381399
Homologene: 66971
Name: olfactory receptor family 6 subfamily C member 6C
Synonyms: GA_x6K02T2PULF-11383575-11384519, MOR110-7, Olfr804
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258068
Homologene: 133581
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 319807
Homologene: 14974
Name: solute carrier family 2 (facilitated glucose transporter), member 7
Synonyms: OTTMUSG00000010396
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 435818
Homologene: 72470
Name: syntrophin, gamma 2
Synonyms: 2210008K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 268534
Homologene: 41298
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 76645
Homologene: 124481
Name: protein phosphatase 1H (PP2C domain containing)
Synonyms: ARHCL1, A430075L18Rik, C030002B11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 319468
Homologene: 18537
Name: myosin, light polypeptide kinase
Synonyms: telokin, Mlck, MLCK210, MLCK108, 9530072E15Rik, A930019C19Rik, nmMlck
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 107589
Homologene: 14202
Name: kinase insert domain protein receptor
Synonyms: VEGF receptor-2, VEGFR-2, vascular endothelial growth factor receptor- 2, VEGFR2, Flk-1, Flk1, orv
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 16542
Homologene: 55639
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213452
Homologene: 19711
Name: olfactory receptor family 52 subfamily S member 1
Synonyms: GA_x6K02T2PBJ9-5927412-5928362, MOR24-2, Olfr593
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258378
Homologene: 27147
Name: PR domain containing 9
Synonyms: Meisetz, G1-419-29, repro7, Dsbc1, Rcr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 213389
Homologene: 104139
Name: unc-5 netrin receptor C
Synonyms: Unc5h3, B130051O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 22253
Homologene: 2765
Name: shisa family member 9
Synonyms: 2700045P11Rik, CKAMP44
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 72555
Homologene: 109462
Name: collagen, type XVII, alpha 1
Synonyms: BPAg2, BP180, Bpag, Bpag2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12821
Homologene: 7276
Name: myeloproliferative leukemia virus oncogene
Synonyms: c-mpl, thrombopoietin receptor, TPO-R, CD110, c-mpl-II, c-mpl-I, hlb219
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17480
Homologene: 7845
Name: protocadherin beta 12
Synonyms: Pcdhb5F, PcdhbL, Pcdh3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93883
Homologene: 87126
Name: cytochrome P450, family 2, subfamily c, polypeptide 40
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13099
Homologene: 74936
Name: predicted gene 9922
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 102633345
VEGA: 14
Name: glutathione S-transferase, alpha 3
Synonyms: Gst2-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14859
Homologene: 37355
Name: osteoclast stimulatory transmembrane protein
Synonyms: 4833422F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74614
Homologene: 41768
Name: cathepsin O
Synonyms: A330105D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229445
Homologene: 1020
Name: SH3-domain GRB2-like (endophilin) interacting protein 1
Synonyms: 3110007P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 73094
Homologene: 13001
Name: selection and upkeep of intraepithelial T cells 8
Synonyms: OTTMUSG00000009475
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 639774
Homologene: 106613
Name: predicted gene 12830
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433746
Name: neuropeptide FF receptor 2
Synonyms: NPFF2, Gpr74
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 104443
Homologene: 56982
Name: LanC (bacterial lantibiotic synthetase component C)-like 2
Synonyms: 1700003F10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 71835
Homologene: 23116
Name: regenerating islet-derived 2
Synonyms: pancreatic thread protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 19693
Homologene: 68517
Name: actin, gamma 2, smooth muscle, enteric
Synonyms: SMGA, Act4, Act-4, Acta3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11468
Homologene: 123845
Name: vomeronasal 2, receptor 20
Synonyms: EG667180
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 667180
Homologene: 84037
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 317653
Homologene: 69348
Name: UPF3 regulator of nonsense transcripts homolog A (yeast)
Synonyms: 4930546M19Rik, RENT3A, UPF3, 2600001C03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67031
Homologene: 23395
Name: defensin, alpha, 35
Synonyms: ENSMUSG00000061845, OTTMUSG00000018258, Gm10104
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100041688
Homologene: 113382
Name: calcium homeostasis modulator family member 4
Synonyms: LOC270711, 4732454E20Rik, Fam26d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 270711
VEGA: 10
Homologene: 19551
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Name: thioredoxin domain containing 15
Synonyms: 2310047H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 69672
VEGA: 13
Homologene: 32594
Name: contactin associated protein-like 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238680
VEGA: 13
Homologene: 129602
Name: kelch-like 33
Synonyms: EG546611
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 546611
VEGA: 14
Homologene: 52385
Name: coiled-coil domain containing 188
Synonyms: Gm7873
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 102638083
VEGA: 16
Homologene: 90442
Name: coxsackie virus and adenovirus receptor
Synonyms: MCAR, 2610206D03Rik, CAR, MCVADR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13052
Homologene: 1024
Name: zinc finger protein 598
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 213753
VEGA: 17
Homologene: 5672
Name: HMG box domain containing 3
Synonyms: 2510002C16Rik, A630042L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 106894
VEGA: 18
Homologene: 44229
Name: EH domain binding protein 1-like 1
Synonyms: G430002G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 114601
VEGA: 19
Homologene: 136059
Name: solute carrier family 22 (organic anion transporter), member 20
Synonyms: LOC381203, mOAT6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 381203
Homologene: 87203
Name: solute carrier family 35 (UDP-galactose transporter), member A2
Synonyms: Sfc8, Had-1, Had1, Ugalt, UGT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 22232
Homologene: 38085
Name: NF-kappaB repressing factor
Synonyms: 9430034D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 77286
Homologene: 84816
Name: cerebellar degeneration related antigen 1
Synonyms: Cdr34, Gm7077, Gm2409
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 631990
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 21,264,894 bp
  • A to C, chromosome 1 at 33,734,861 bp
  • C to G, chromosome 1 at 53,405,690 bp
  • T to C, chromosome 1 at 58,413,033 bp
  • A to G, chromosome 1 at 72,307,576 bp
  • C to A, chromosome 1 at 132,456,864 bp
  • T to C, chromosome 1 at 139,438,984 bp
  • T to C, chromosome 1 at 139,482,511 bp
  • T to A, chromosome 1 at 153,077,001 bp
  • A to T, chromosome 1 at 153,465,695 bp
  • T to C, chromosome 1 at 156,442,453 bp
  • T to C, chromosome 1 at 163,312,559 bp
  • T to C, chromosome 1 at 172,234,987 bp
  • T to C, chromosome 1 at 177,448,616 bp
  • T to A, chromosome 1 at 178,475,904 bp
  • T to C, chromosome 2 at 24,987,195 bp
  • A to C, chromosome 2 at 26,986,989 bp
  • C to T, chromosome 2 at 33,157,923 bp
  • T to C, chromosome 2 at 35,376,259 bp
  • A to T, chromosome 2 at 37,379,008 bp
  • G to T, chromosome 2 at 72,226,030 bp
  • A to T, chromosome 2 at 122,517,553 bp
  • T to C, chromosome 2 at 153,959,683 bp
  • T to C, chromosome 2 at 155,630,672 bp
  • T to C, chromosome 2 at 165,395,992 bp
  • G to A, chromosome 3 at 81,944,861 bp
  • C to T, chromosome 3 at 132,734,407 bp
  • G to C, chromosome 3 at 141,733,933 bp
  • T to C, chromosome 4 at 43,640,904 bp
  • T to C, chromosome 4 at 74,345,567 bp
  • T to A, chromosome 4 at 82,296,737 bp
  • T to C, chromosome 4 at 99,034,469 bp
  • T to C, chromosome 4 at 102,915,157 bp
  • T to C, chromosome 4 at 111,938,867 bp
  • T to A, chromosome 4 at 114,844,976 bp
  • T to G, chromosome 4 at 118,446,038 bp
  • T to C, chromosome 4 at 126,443,166 bp
  • A to T, chromosome 4 at 149,663,220 bp
  • G to A, chromosome 4 at 150,158,071 bp
  • A to G, chromosome 5 at 4,069,038 bp
  • A to C, chromosome 5 at 8,939,835 bp
  • G to T, chromosome 5 at 24,434,346 bp
  • T to C, chromosome 5 at 63,807,218 bp
  • A to G, chromosome 5 at 66,310,988 bp
  • A to G, chromosome 5 at 75,946,927 bp
  • G to A, chromosome 5 at 89,583,347 bp
  • A to G, chromosome 5 at 91,032,214 bp
  • T to C, chromosome 5 at 114,419,469 bp
  • A to G, chromosome 6 at 3,536,853 bp
  • A to G, chromosome 6 at 57,703,132 bp
  • G to A, chromosome 6 at 78,406,186 bp
  • A to T, chromosome 6 at 83,519,914 bp
  • G to A, chromosome 6 at 100,573,627 bp
  • T to C, chromosome 6 at 123,386,104 bp
  • A to C, chromosome 6 at 132,893,378 bp
  • C to T, chromosome 7 at 29,348,350 bp
  • A to T, chromosome 7 at 43,694,345 bp
  • A to T, chromosome 7 at 45,308,706 bp
  • T to C, chromosome 7 at 47,079,294 bp
  • T to C, chromosome 7 at 83,722,554 bp
  • A to C, chromosome 7 at 102,152,428 bp
  • T to A, chromosome 7 at 103,212,721 bp
  • T to A, chromosome 7 at 118,529,717 bp
  • A to T, chromosome 7 at 128,205,935 bp
  • G to A, chromosome 8 at 13,795,500 bp
  • G to A, chromosome 8 at 21,065,855 bp
  • A to T, chromosome 8 at 23,104,809 bp
  • C to T, chromosome 8 at 48,341,034 bp
  • G to A, chromosome 8 at 72,200,460 bp
  • A to G, chromosome 8 at 84,721,774 bp
  • C to A, chromosome 8 at 84,843,031 bp
  • A to G, chromosome 8 at 116,997,576 bp
  • T to A, chromosome 8 at 126,438,928 bp
  • A to T, chromosome 8 at 127,376,897 bp
  • A to G, chromosome 9 at 57,110,912 bp
  • T to A, chromosome 9 at 79,600,011 bp
  • A to G, chromosome 10 at 34,044,047 bp
  • A to G, chromosome 10 at 58,479,868 bp
  • C to T, chromosome 10 at 61,113,437 bp
  • T to C, chromosome 10 at 120,937,110 bp
  • A to G, chromosome 10 at 122,920,782 bp
  • A to G, chromosome 10 at 129,705,139 bp
  • A to T, chromosome 11 at 22,836,860 bp
  • C to A, chromosome 11 at 66,026,972 bp
  • C to T, chromosome 11 at 69,357,018 bp
  • T to C, chromosome 12 at 30,226,773 bp
  • T to C, chromosome 13 at 13,965,667 bp
  • C to A, chromosome 13 at 51,725,311 bp
  • T to C, chromosome 13 at 55,724,582 bp
  • T to A, chromosome 13 at 64,757,436 bp
  • A to T, chromosome 13 at 69,499,932 bp
  • A to C, chromosome 14 at 28,141,225 bp
  • T to G, chromosome 14 at 50,891,411 bp
  • C to A, chromosome 14 at 101,729,693 bp
  • A to G, chromosome 15 at 27,567,572 bp
  • A to G, chromosome 15 at 33,594,151 bp
  • C to T, chromosome 15 at 36,597,493 bp
  • A to G, chromosome 15 at 78,976,540 bp
  • A to T, chromosome 15 at 93,441,707 bp
  • T to C, chromosome 16 at 5,031,972 bp
  • G to A, chromosome 16 at 11,997,123 bp
  • T to C, chromosome 16 at 18,219,305 bp
  • A to C, chromosome 16 at 34,912,297 bp
  • C to T, chromosome 16 at 55,925,058 bp
  • A to T, chromosome 16 at 78,334,948 bp
  • T to A, chromosome 16 at 93,884,511 bp
  • TGCTGGCTTCAGGGCCACAGTCCGCTG to TGCTG, chromosome 17 at 12,271,015 bp
  • G to A, chromosome 17 at 15,557,384 bp
  • T to C, chromosome 17 at 24,678,584 bp
  • A to G, chromosome 17 at 35,150,915 bp
  • G to T, chromosome 17 at 57,081,182 bp
  • A to G, chromosome 17 at 64,139,016 bp
  • A to T, chromosome 17 at 67,901,429 bp
  • A to G, chromosome 17 at 80,274,881 bp
  • G to T, chromosome 18 at 37,436,121 bp
  • G to A, chromosome 18 at 61,155,128 bp
  • T to C, chromosome 19 at 5,720,570 bp
  • A to T, chromosome 19 at 5,972,957 bp
  • T to A, chromosome 19 at 9,002,495 bp
  • A to T, chromosome 19 at 37,981,266 bp
  • A to T, chromosome 19 at 39,778,051 bp
  • T to G, chromosome 19 at 40,160,671 bp
  • T to A, chromosome 19 at 45,794,075 bp
  • G to T, chromosome 19 at 47,501,673 bp
  • G to T, chromosome 19 at 47,671,362 bp
  • T to A, chromosome X at 7,889,662 bp
  • T to C, chromosome X at 36,890,116 bp
  • T to A, chromosome X at 61,185,302 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0309 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038519-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.