Strain Name:
C57BL/6J-MtgxR0362Btlr/Mmmh
Stock Number:
038568-MU
Citation ID:
RRID:MMRRC_038568-MU
Other Names:
R0362 (G1), C57BL/6J-MtgxR0362Btlr
Major Collection:

Strain Information

Prkar2b
Name: protein kinase, cAMP dependent regulatory, type II beta
Synonyms: PKARIIbeta, RII(beta), Pkarb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 19088
HGNC: HGNC:9392
Homologene: 37666
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: Her4, ErbB4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Ulk2
Name: unc-51 like kinase 2
Synonyms: Unc51.2, A830085I22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 29869
Homologene: 5891
Slc17a6
Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
Synonyms: 2900073D12Rik, VGLUT2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 140919
Homologene: 121617
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Tbce
Name: tubulin-specific chaperone E
Synonyms: 2610206D02Rik, C530005D02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 70430
Homologene: 37744
Egr1
Name: early growth response 1
Synonyms: Zif268, NGFIA, Egr-1, NGF1-A, TIS8, Krox24, Krox-24, Zfp-6, NGFI-A, Zenk, ETR103, A530045N19Rik, Krox-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13653
HGNC: HGNC:3238
Homologene: 56394
Golga4
Name: golgin A4
Synonyms: Olp-1, golgin-245
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 54214
HGNC: HGNC:4427
Homologene: 68224
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Ticrr
Name: TOPBP1-interacting checkpoint and replication regulator
Synonyms: 5730590G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 77011
Homologene: 67120
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: Gcn1l1, G431004K08Rik, GCN1L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Ppp6r3
Name: protein phosphatase 6, regulatory subunit 3
Synonyms: Pptcs3, Saps3, Pp6r3, D19Bwg1430e, 9130026N02Rik, 4930528G08Rik, D19Ertd703e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 52036
VEGA: 19
HGNC: HGNC:1173
Homologene: 115911
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, Helic1, B630009I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 70699
Homologene: 45971
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: GCP5, B130010C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233276
Homologene: 14172
Pafah1b1
Name: platelet-activating factor acetylhydrolase, isoform 1b, subunit 1
Synonyms: Mdsh, lissencephaly-1 protein, Lis1, PAF-AH 45, LIS-1, Pafaha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18472
HGNC: HGNC:8574
Homologene: 371
Gpat4
Name: glycerol-3-phosphate acyltransferase 4
Synonyms: Agpat6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102247
Homologene: 32425
Fancc
Name: Fanconi anemia, complementation group C
Synonyms: Facc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 14088
HGNC: HGNC:3584
Homologene: 109
Heatr5a
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Plekha5
Name: pleckstrin homology domain containing, family A member 5
Synonyms: PEPP2, 2810431N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 109135
Homologene: 10377
Myo9b
Name: myosin IXb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 17925
HGNC: HGNC:7609
Homologene: 3058
Mdn1
Name: midasin AAA ATPase 1
Synonyms: D4Abb1e, LOC213784, 4833432B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100019
Homologene: 39689
Taf2
Name: TATA-box binding protein associated factor 2
Synonyms: 150kDa, 4732460C16Rik, TAFII150, TAF2B, CIF150
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 319944
VEGA: 15
Homologene: 31137
Vdac1
Name: voltage-dependent anion channel 1
Synonyms: Vdac5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 22333
Homologene: 107244
Ric1
Name: RAB6A GEF complex partner 1
Synonyms: C030046E11Rik, C130057E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226089
Homologene: 13806
Psmg1
Name: proteasome (prosome, macropain) assembly chaperone 1
Synonyms: Dscr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 56088
HGNC: HGNC:3043
Homologene: 2759
Vps8
Name: VPS8 CORVET complex subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 209018
Homologene: 44592
Myt1
Name: myelin transcription factor 1
Synonyms: Nztf2, NZF-2a, Nzf2, NZF-2b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17932
HGNC: HGNC:7622
Homologene: 3332
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: Odz4, l7Rn3, Doc4, Ten-m4, l(7)-3Rn, ELM2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 23966
Homologene: 8034
Tnc
Name: tenascin C
Synonyms: TN, C130033P17Rik, TN-C, cytotactin, Hxb, hexabrachion, tenascin-C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
Nlrp3
Name: NLR family, pyrin domain containing 3
Synonyms: Cias1, NALP3, Mmig1, cryopyrin, Pypaf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216799
Homologene: 3600
Btnl9
Name: butyrophilin-like 9
Synonyms: D330012D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237754
Homologene: 68540
P4hb
Name: prolyl 4-hydroxylase, beta polypeptide
Synonyms: ERp59, protein disulfide isomerase, Thbp, PDI, Pdia1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18453
HGNC: HGNC:8548
Homologene: 55495
Stmn2
Name: stathmin-like 2
Synonyms: SCG10, Scgn10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20257
Homologene: 5102
Zfp12
Name: zinc finger protein 12
Synonyms: Zfp-12, Krox-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231866
Homologene: 65328
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: b2b414Clo, 4432416O06Rik, m407Asp, m152Asp, D030010H02Rik, Dnchc2, D330044F14Rik, DHC2, DHC1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Nxf1
Name: nuclear RNA export factor 1
Synonyms: Mvb1, Mex67, TAP, Tip associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 53319
HGNC: HGNC:8071
Homologene: 38176
Tut1
Name: terminal uridylyl transferase 1, U6 snRNA-specific
Synonyms: Tent1, PAPD2, TUTase6, Rbm21, 2700038E08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 70044
VEGA: 19
Homologene: 69361
Eml2
Name: echinoderm microtubule associated protein like 2
Synonyms: 1600029N02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72205
Homologene: 8125
Tecpr2
Name: tectonin beta-propeller repeat containing 2
Synonyms: 4930573I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104859
VEGA: 12
Homologene: 8897
Dhx29
Name: DExH-box helicase 29
Synonyms: DEAH (Asp-Glu-Ala-His) box polypeptide 29, E130202M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218629
VEGA: 13
Homologene: 10387
Eno4
Name: enolase 4
Synonyms: 6430537H07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226265
Homologene: 18691
Edc4
Name: enhancer of mRNA decapping 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234699
Homologene: 40937
Sohlh2
Name: spermatogenesis and oogenesis specific basic helix-loop-helix 2
Synonyms: 4933406N12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74434
Homologene: 9864
Stat5a
Name: signal transducer and activator of transcription 5A
Synonyms: STAT5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20850
Homologene: 20680
Pkd2l2
Name: polycystic kidney disease 2-like 2
Synonyms: Polycystin - L2, TRPP5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 53871
VEGA: 18
HGNC: HGNC:9012
Homologene: 22812
Lig1
Name: ligase I, DNA, ATP-dependent
Synonyms: mLigI, LigI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16881
HGNC: HGNC:6598
Homologene: 197
Adamts6
Name: ADAM metallopeptidase with thrombospondin type 1 motif 6
Synonyms: b2b1879.1Clo, A930019D11Rik, b2b2228Clo, b2b2029Clo, b2b2182Clo, ADAM-TS6, b2b2187.1Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 108154
VEGA: 13
HGNC: HGNC:222
Homologene: 82573
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Col11a2
Name: collagen, type XI, alpha 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12815
HGNC: HGNC:2187
Homologene: 22547
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: 2810003K23Rik, Dnahc17, Dnahcl1, LOC382552
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Il1rl1
Name: interleukin 1 receptor-like 1
Synonyms: St2, Ly84, ST2L, T1/ST2, ST2, Fit-1, T1 gene, St2-rs1, DER4, T1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17082
HGNC: HGNC:5998
Homologene: 2862
Zfyve9
Name: zinc finger, FYVE domain containing 9
Synonyms: Madhip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230597
HGNC: HGNC:6775
Homologene: 3527
Magi2
Name: membrane associated guanylate kinase, WW and PDZ domain containing 2
Synonyms: S-SCAM, Acvrinp1, Magi-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 50791
Homologene: 8189
Drc7
Name: dynein regulatory complex subunit 7
Synonyms: SRG-L, Ccdc135, LOC330830
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 330830
Homologene: 12996
Exoc7
Name: exocyst complex component 7
Synonyms: Exo70, 70kDa, sec70
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 53413
Homologene: 41019
Gucy2d
Name: guanylate cyclase 2d
Synonyms: guanylyl cyclase D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14918
Homologene: 71540
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 381522
Homologene: 117988
Slfn10-ps
Name: schlafen 10, pseudogene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237887
Acp3
Name: acid phosphatase 3
Synonyms: PAP, A030005E02Rik, Acpp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56318
HGNC: HGNC:125
Homologene: 55552
Rp1l1
Name: retinitis pigmentosa 1 homolog like 1
Synonyms: Dcdc4, Rp1hl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 271209
VEGA: 14
Homologene: 105870
Pld5
Name: phospholipase D family member 5
Synonyms: B230365F16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319455
Homologene: 16081
Dcdc2b
Name: doublecortin domain containing 2b
Synonyms: Gm12964, LOC384062
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100504491
Homologene: 82651
Rxfp1
Name: relaxin/insulin-like family peptide receptor 1
Synonyms: LOC381489, Lgr7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 381489
Homologene: 11007
Zswim8
Name: zinc finger SWIM-type containing 8
Synonyms: 2310021P13Rik, 4832404P21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 268721
VEGA: 14
Homologene: 34313
Map7d1
Name: MAP7 domain containing 1
Synonyms: Rprc1, Mtap7d1, Parcc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 245877
Homologene: 17009
Daam2
Name: dishevelled associated activator of morphogenesis 2
Synonyms: 2310016D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 76441
VEGA: 17
Homologene: 69186
Ctcfl
Name: CCCTC-binding factor like
Synonyms: Boris, OTTMUSG00000016680
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 664799
Homologene: 46476
Mrpl53
Name: mitochondrial ribosomal protein L53
Synonyms: 1110007K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68499
Homologene: 12270
Simc1
Name: SUMO-interacting motifs containing 1
Synonyms: 4732471D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 319719
Homologene: 131217
Ddx28
Name: DEAD box helicase 28
Synonyms: Mddx28, 2410004K13Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 71986
Homologene: 10164
Serpina6
Name: serine (or cysteine) peptidase inhibitor, clade A, member 6
Synonyms: Cbg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 12401
HGNC: HGNC:1540
Homologene: 20417
Has2
Name: hyaluronan synthase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 15117
HGNC: HGNC:4819
Homologene: 3892
Slc34a1
Name: solute carrier family 34 (sodium phosphate), member 1
Synonyms: Npt2, Na/Pi cotransporter, renal Na+/Pi transporter, Slc17a2, NaPi-IIa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20505
VEGA: 13
Homologene: 20663
Slc26a11
Name: solute carrier family 26, member 11
Synonyms: F630021I08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268512
Homologene: 13685
Adam7
Name: a disintegrin and metallopeptidase domain 7
Synonyms: EAP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 11500
HGNC: HGNC:214
Homologene: 2830
Or7a36
Name: olfactory receptor family 7 subfamily A member 36
Synonyms: MOR139-1, Olfr1352, GA_x6K02T2QGN0-2828447-2827518
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 259074
HGNC: HGNC:8356
Homologene: 131141
Ctsk
Name: cathepsin K
Synonyms: catK, Cat K
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 13038
HGNC: HGNC:2536
Homologene: 68053
Sptlc3
Name: serine palmitoyltransferase, long chain base subunit 3
Synonyms: C130053K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228677
Homologene: 105590
Fam83e
Name: family with sequence similarity 83, member E
Synonyms: 4930403C10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 73813
Homologene: 9791
Ttbk2
Name: tau tubulin kinase 2
Synonyms: B930008N24Rik, 2610507N02Rik, TTK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 140810
Homologene: 62795
Spag6l
Name: sperm associated antigen 6-like
Synonyms: Spag6, PF16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 50525
Homologene: 8252
4932414N04Rik
Name: RIKEN cDNA 4932414N04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 75721
Homologene: 138468
Fhod3
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225288
VEGA: 18
Homologene: 45323
Mfsd4a
Name: major facilitator superfamily domain containing 4A
Synonyms: Mfsd4, A930031D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213006
Homologene: 45419
Gm14221
Name: predicted gene 14221
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 105244348
Ecm1
Name: extracellular matrix protein 1
Synonyms: p85
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 13601
HGNC: HGNC:3153
Homologene: 3260
Eeig2
Name: EEIG family member 2
Synonyms: 1600010D10Rik, Fam102b, B430201A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329739
Homologene: 46568
Stpg1
Name: sperm tail PG rich repeat containing 1
Synonyms: 4930403G18Rik, 4930555I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 78806
Homologene: 12705
Radil
Name: Ras association and DIL domains
Synonyms: D930005D10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231858
Homologene: 77648
AC153851.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Foxi3
Name: forkhead box I3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232077
Homologene: 52949
Zfp974
Name: zinc finger protein 974
Synonyms: 1700049G17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 73430
Plpp5
Name: phospholipid phosphatase 5
Synonyms: 2310022A04Rik, Ppapdc1b, 1810019D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 71910
Homologene: 100569
Ciao2b
Name: cytosolic iron-sulfur assembly component 2B
Synonyms: 1110019N10Rik, Fam96b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 68523
Homologene: 6115
Zdhhc7
Name: zinc finger, DHHC domain containing 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102193
Homologene: 41193
Mtnr1b
Name: melatonin receptor 1B
Synonyms: Mt2, Mel1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244701
HGNC: HGNC:7464
Homologene: 4350
St3gal4
Name: ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Synonyms: Siat4c, ST3Gal IV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20443
VEGA: 9
Homologene: 4572
Trappc1
Name: trafficking protein particle complex 1
Synonyms: MUM2, BET5, D11Ertd172e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 245828
Homologene: 41425
Ifi35
Name: interferon-induced protein 35
Synonyms: IFP35, 2010008K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70110
HGNC: HGNC:5399
Homologene: 4040
Wdr35
Name: WD repeat domain 35
Synonyms: 4930459M12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 74682
Homologene: 10814
Atg10
Name: autophagy related 10
Synonyms: 5430428K15Rik, Apg10l, APG10, Apg10p, 5330424L23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 66795
VEGA: 13
Homologene: 12036
Parp8
Name: poly (ADP-ribose) polymerase family, member 8
Synonyms: 2810430O08Rik, D13Ertd275e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 52552
VEGA: 13
Homologene: 11621
Vmn2r124
Name: vomeronasal 2, receptor 124
Synonyms: Gm7196, Vmn2r-ps113
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 637021
Homologene: 115024
Spag6
Name: sperm associated antigen 6
Synonyms: BC061194, Spag6l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381350
Homologene: 133723
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CTTGTTGTTGTTGTTGTTG to CTTGTTGTTGTTGTTGTTGTTG, chromosome 1 at 40,442,574 bp
  • TGT to TGTCGT, chromosome 1 at 40,442,582 bp
  • A to T, chromosome 1 at 68,330,270 bp
  • A to T, chromosome 1 at 132,059,275 bp
  • A to T, chromosome 1 at 175,975,580 bp
  • T to A, chromosome 2 at 18,710,491 bp
  • A to G, chromosome 2 at 68,732,917 bp
  • A to T, chromosome 2 at 120,745,783 bp
  • T to C, chromosome 2 at 125,309,777 bp
  • A to G, chromosome 2 at 139,546,555 bp
  • T to C, chromosome 2 at 160,568,390 bp
  • A to G, chromosome 2 at 173,118,443 bp
  • A to T, chromosome 2 at 181,763,393 bp
  • A to T, chromosome 3 at 8,545,690 bp
  • A to G, chromosome 3 at 55,207,742 bp
  • A to T, chromosome 3 at 79,737,793 bp
  • A to T, chromosome 3 at 95,500,944 bp
  • A to G, chromosome 3 at 95,737,057 bp
  • C to T, chromosome 3 at 108,980,181 bp
  • A to T, chromosome 4 at 32,746,439 bp
  • A to G, chromosome 4 at 45,923,551 bp
  • A to C, chromosome 4 at 64,017,442 bp
  • T to A, chromosome 4 at 108,680,969 bp
  • G to T, chromosome 4 at 126,234,994 bp
  • T to C, chromosome 4 at 129,610,238 bp
  • C to T, chromosome 4 at 135,506,466 bp
  • A to G, chromosome 5 at 19,227,575 bp
  • T to C, chromosome 5 at 115,576,108 bp
  • T to C, chromosome 5 at 142,543,827 bp
  • C to A, chromosome 5 at 143,245,223 bp
  • T to A, chromosome 6 at 35,196,714 bp
  • C to T, chromosome 6 at 41,119,059 bp
  • A to G, chromosome 6 at 70,956,628 bp
  • T to C, chromosome 6 at 73,208,609 bp
  • C to T, chromosome 6 at 83,109,545 bp
  • G to A, chromosome 6 at 140,591,747 bp
  • T to A, chromosome 7 at 13,296,804 bp
  • A to G, chromosome 7 at 19,190,806 bp
  • A to T, chromosome 7 at 27,927,394 bp
  • G to T, chromosome 7 at 45,726,969 bp
  • A to G, chromosome 7 at 51,658,771 bp
  • A to G, chromosome 7 at 55,800,684 bp
  • A to G, chromosome 7 at 79,677,340 bp
  • T to A, chromosome 7 at 96,772,035 bp
  • A to T, chromosome 7 at 98,443,685 bp
  • T to C, chromosome 8 at 23,180,933 bp
  • A to T, chromosome 8 at 25,724,192 bp
  • T to C, chromosome 8 at 71,347,770 bp
  • T to C, chromosome 8 at 95,072,855 bp
  • T to C, chromosome 8 at 104,641,590 bp
  • C to G, chromosome 8 at 105,886,775 bp
  • C to T, chromosome 8 at 106,011,294 bp
  • T to A, chromosome 8 at 120,086,647 bp
  • T to C, chromosome 9 at 7,005,487 bp
  • C to T, chromosome 9 at 15,874,304 bp
  • T to A, chromosome 9 at 35,053,173 bp
  • T to C, chromosome 9 at 53,458,838 bp
  • A to G, chromosome 9 at 104,314,427 bp
  • T to A, chromosome 9 at 118,555,785 bp
  • T to C, chromosome 10 at 50,748,955 bp
  • A to T, chromosome 10 at 78,984,386 bp
  • C to T, chromosome 11 at 49,169,616 bp
  • T to C, chromosome 11 at 52,374,973 bp
  • T to C, chromosome 11 at 59,548,797 bp
  • C to A, chromosome 11 at 61,787,586 bp
  • C to A, chromosome 11 at 69,325,576 bp
  • T to C, chromosome 11 at 74,683,631 bp
  • C to T, chromosome 11 at 79,536,878 bp
  • T to A, chromosome 11 at 83,035,774 bp
  • T to A, chromosome 11 at 100,882,083 bp
  • T to C, chromosome 11 at 101,457,212 bp
  • G to T, chromosome 11 at 116,295,662 bp
  • A to T, chromosome 11 at 118,098,539 bp
  • T to A, chromosome 11 at 119,379,941 bp
  • T to C, chromosome 11 at 120,563,336 bp
  • T to C, chromosome 12 at 8,995,625 bp
  • A to T, chromosome 12 at 31,987,974 bp
  • A to T, chromosome 12 at 51,888,861 bp
  • G to T, chromosome 12 at 103,651,949 bp
  • A to G, chromosome 12 at 110,968,940 bp
  • T to C, chromosome 13 at 13,998,162 bp
  • T to C, chromosome 13 at 54,528,467 bp
  • T to A, chromosome 13 at 55,402,898 bp
  • A to T, chromosome 13 at 63,398,156 bp
  • T to C, chromosome 13 at 91,040,990 bp
  • A to G, chromosome 13 at 104,390,076 bp
  • T to A, chromosome 13 at 112,962,859 bp
  • G to A, chromosome 13 at 116,924,968 bp
  • T to A, chromosome 14 at 20,721,945 bp
  • T to A, chromosome 14 at 64,031,066 bp
  • A to G, chromosome 14 at 68,509,656 bp
  • A to T, chromosome 15 at 55,045,929 bp
  • A to C, chromosome 15 at 56,681,661 bp
  • T to C, chromosome 16 at 21,608,227 bp
  • A to T, chromosome 16 at 95,987,971 bp
  • T to C, chromosome 17 at 18,064,224 bp
  • T to A, chromosome 17 at 34,062,446 bp
  • G to C, chromosome 17 at 49,480,785 bp
  • T to A, chromosome 18 at 25,090,076 bp
  • A to C, chromosome 18 at 34,435,327 bp
  • A to G, chromosome 18 at 34,863,313 bp
  • A to G, chromosome 19 at 3,478,285 bp
  • T to C, chromosome 19 at 8,764,151 bp
  • T to C, chromosome 19 at 8,955,527 bp
  • T to C, chromosome 19 at 29,601,011 bp
  • A to G, chromosome 19 at 58,943,624 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0362 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038568-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.