Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0362Btlr/Mmmh
Stock Number:
038568-MU
Citation ID:
RRID:MMRRC_038568-MU
Other Names:
R0362 (G1), C57BL/6J-MtgxR0362Btlr
Major Collection:

Strain Information

Prkar2b
Name: protein kinase, cAMP dependent regulatory, type II beta
Synonyms: Pkarb2, RII(beta), PKARIIbeta
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19088
HGNC: HGNC:9392
Homologene: 37666
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Ulk2
Name: unc-51 like kinase 2
Synonyms: Unc51.2, A830085I22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 29869
Homologene: 5891
Slc17a6
Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
Synonyms: 2900073D12Rik, VGLUT2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 140919
Homologene: 121617
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Tbce
Name: tubulin-specific chaperone E
Synonyms: 2610206D02Rik, C530005D02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70430
Homologene: 37744
Egr1
Name: early growth response 1
Synonyms: TIS8, NGFIA, Krox24, Zenk, Zif268, ETR103, Krox-24, Krox-1, Egr-1, Zfp-6, NGF1-A, A530045N19Rik, NGFI-A
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13653
HGNC: HGNC:3238
Homologene: 56394
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CTTGTTGTTGTTGTTGTTG to CTTGTTGTTGTTGTTGTTGTTG, chromosome 1 at 40,442,574 bp
  • TGT to TGTCGT, chromosome 1 at 40,442,582 bp
  • A to T, chromosome 1 at 68,330,270 bp
  • A to T, chromosome 1 at 132,059,275 bp
  • A to T, chromosome 1 at 175,975,580 bp
  • T to A, chromosome 2 at 18,710,491 bp
  • A to G, chromosome 2 at 68,732,917 bp
  • A to T, chromosome 2 at 120,745,783 bp
  • T to C, chromosome 2 at 125,309,777 bp
  • A to G, chromosome 2 at 139,546,555 bp
  • T to C, chromosome 2 at 160,568,390 bp
  • A to G, chromosome 2 at 173,118,443 bp
  • A to T, chromosome 2 at 181,763,393 bp
  • A to T, chromosome 3 at 8,545,690 bp
  • A to G, chromosome 3 at 55,207,742 bp
  • A to T, chromosome 3 at 79,737,793 bp
  • A to T, chromosome 3 at 95,500,944 bp
  • A to G, chromosome 3 at 95,737,057 bp
  • C to T, chromosome 3 at 108,980,181 bp
  • A to T, chromosome 4 at 32,746,439 bp
  • A to G, chromosome 4 at 45,923,551 bp
  • A to C, chromosome 4 at 64,017,442 bp
  • T to A, chromosome 4 at 108,680,969 bp
  • G to T, chromosome 4 at 126,234,994 bp
  • T to C, chromosome 4 at 129,610,238 bp
  • C to T, chromosome 4 at 135,506,466 bp
  • A to G, chromosome 5 at 19,227,575 bp
  • T to C, chromosome 5 at 115,576,108 bp
  • T to C, chromosome 5 at 142,543,827 bp
  • C to A, chromosome 5 at 143,245,223 bp
  • T to A, chromosome 6 at 35,196,714 bp
  • C to T, chromosome 6 at 41,119,059 bp
  • A to G, chromosome 6 at 70,956,628 bp
  • T to C, chromosome 6 at 73,208,609 bp
  • C to T, chromosome 6 at 83,109,545 bp
  • G to A, chromosome 6 at 140,591,747 bp
  • T to A, chromosome 7 at 13,296,804 bp
  • A to G, chromosome 7 at 19,190,806 bp
  • A to T, chromosome 7 at 27,927,394 bp
  • G to T, chromosome 7 at 45,726,969 bp
  • A to G, chromosome 7 at 51,658,771 bp
  • A to G, chromosome 7 at 55,800,684 bp
  • A to G, chromosome 7 at 79,677,340 bp
  • T to A, chromosome 7 at 96,772,035 bp
  • A to T, chromosome 7 at 98,443,685 bp
  • T to C, chromosome 8 at 23,180,933 bp
  • A to T, chromosome 8 at 25,724,192 bp
  • T to C, chromosome 8 at 71,347,770 bp
  • T to C, chromosome 8 at 95,072,855 bp
  • T to C, chromosome 8 at 104,641,590 bp
  • C to G, chromosome 8 at 105,886,775 bp
  • C to T, chromosome 8 at 106,011,294 bp
  • T to A, chromosome 8 at 120,086,647 bp
  • T to C, chromosome 9 at 7,005,487 bp
  • C to T, chromosome 9 at 15,874,304 bp
  • T to A, chromosome 9 at 35,053,173 bp
  • T to C, chromosome 9 at 53,458,838 bp
  • A to G, chromosome 9 at 104,314,427 bp
  • T to A, chromosome 9 at 118,555,785 bp
  • T to C, chromosome 10 at 50,748,955 bp
  • A to T, chromosome 10 at 78,984,386 bp
  • C to T, chromosome 11 at 49,169,616 bp
  • T to C, chromosome 11 at 52,374,973 bp
  • T to C, chromosome 11 at 59,548,797 bp
  • C to A, chromosome 11 at 61,787,586 bp
  • C to A, chromosome 11 at 69,325,576 bp
  • T to C, chromosome 11 at 74,683,631 bp
  • C to T, chromosome 11 at 79,536,878 bp
  • T to A, chromosome 11 at 83,035,774 bp
  • T to A, chromosome 11 at 100,882,083 bp
  • T to C, chromosome 11 at 101,457,212 bp
  • G to T, chromosome 11 at 116,295,662 bp
  • A to T, chromosome 11 at 118,098,539 bp
  • T to A, chromosome 11 at 119,379,941 bp
  • T to C, chromosome 11 at 120,563,336 bp
  • T to C, chromosome 12 at 8,995,625 bp
  • A to T, chromosome 12 at 31,987,974 bp
  • A to T, chromosome 12 at 51,888,861 bp
  • G to T, chromosome 12 at 103,651,949 bp
  • A to G, chromosome 12 at 110,968,940 bp
  • T to C, chromosome 13 at 13,998,162 bp
  • T to C, chromosome 13 at 54,528,467 bp
  • T to A, chromosome 13 at 55,402,898 bp
  • A to T, chromosome 13 at 63,398,156 bp
  • T to C, chromosome 13 at 91,040,990 bp
  • A to G, chromosome 13 at 104,390,076 bp
  • T to A, chromosome 13 at 112,962,859 bp
  • G to A, chromosome 13 at 116,924,968 bp
  • T to A, chromosome 14 at 20,721,945 bp
  • T to A, chromosome 14 at 64,031,066 bp
  • A to G, chromosome 14 at 68,509,656 bp
  • A to T, chromosome 15 at 55,045,929 bp
  • A to C, chromosome 15 at 56,681,661 bp
  • T to C, chromosome 16 at 21,608,227 bp
  • A to T, chromosome 16 at 95,987,971 bp
  • T to C, chromosome 17 at 18,064,224 bp
  • T to A, chromosome 17 at 34,062,446 bp
  • G to C, chromosome 17 at 49,480,785 bp
  • T to A, chromosome 18 at 25,090,076 bp
  • A to C, chromosome 18 at 34,435,327 bp
  • A to G, chromosome 18 at 34,863,313 bp
  • A to G, chromosome 19 at 3,478,285 bp
  • T to C, chromosome 19 at 8,764,151 bp
  • T to C, chromosome 19 at 8,955,527 bp
  • T to C, chromosome 19 at 29,601,011 bp
  • A to G, chromosome 19 at 58,943,624 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0362 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038568-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.