Strain Name:
C57BL/6J-MtgxR0420Btlr/Mmmh
Stock Number:
038622-MU
Citation ID:
RRID:MMRRC_038622-MU
Other Names:
R0420 (G1), C57BL/6J-MtgxR0420Btlr
Major Collection:

Strain Information

Nfat5
Name: nuclear factor of activated T cells 5
Synonyms: nfatz, TonEBP, B130038B15Rik, OREBP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 54446
HGNC: HGNC:7774
Homologene: 4811
Ap4e1
Name: adaptor-related protein complex AP-4, epsilon 1
Synonyms: 2310033A20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 108011
HGNC: HGNC:573
Homologene: 22397
Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 52850
Homologene: 64485
Tex49
Name: testis expressed 49
Synonyms: 4930415O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 73863
VEGA: 15
Homologene: 19174
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 245944
Homologene: 5605
Ppm1e
Name: protein phosphatase 1E (PP2C domain containing)
Synonyms: PP2CH, POPX1, B930008A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 320472
Homologene: 22848
Ociad1
Name: OCIA domain containing 1
Synonyms: expressed during mesenchymal induction 2, Emi2, B230209J16Rik, 6030432N09Rik, TPA018, Asrij, Imi2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 68095
Homologene: 9866
Rbbp5
Name: retinoblastoma binding protein 5, histone lysine methyltransferase complex subunit
Synonyms: 4933411J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213464
HGNC: HGNC:9888
Homologene: 3709
Supt5
Name: suppressor of Ty 5, DSIF elongation factor subunit
Synonyms: Spt5, Supt5h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20924
Homologene: 2384
Mynn
Name: myoneurin
Synonyms: SBBIZ1, 2810011C24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 80732
Homologene: 10253
Rnpc3
Name: RNA-binding region (RNP1, RRM) containing 3
Synonyms: C030014B17Rik, 2810441O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67225
Homologene: 9746
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 23964
Homologene: 22672
Zic2
Name: zinc finger protein of the cerebellum 2
Synonyms: GENA 29, Ku, odd-paired homolog
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 22772
Homologene: 5171
Gabbr1
Name: gamma-aminobutyric acid (GABA) B receptor, 1
Synonyms: GABAbR1, GABAB1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 54393
HGNC: HGNC:4070
Homologene: 1132
Sox14
Name: SRY (sex determining region Y)-box 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20669
Homologene: 31224
Mcm9
Name: minichromosome maintenance 9 homologous recombination repair factor
Synonyms: 9030408O17Rik, Mcmdc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 71567
VEGA: 10
Homologene: 13546
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 23966
Homologene: 8034
Atp6v1b1
Name: ATPase, H+ transporting, lysosomal V1 subunit B1
Synonyms: Vpp3, Vpp-3, Atp6b1, lysosomal 56/58kDa, D630039P21Rik, D630030L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 110935
HGNC: HGNC:853
Homologene: 68198
Tnc
Name: tenascin C
Synonyms: Hxb, TN-C, TN, C130033P17Rik, tenascin-C, cytotactin, hexabrachion
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
Arnt
Name: aryl hydrocarbon receptor nuclear translocator
Synonyms: Hif1b, ESTM42, D3Ertd557e, bHLHe2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 11863
HGNC: HGNC:700
Homologene: 1261
Grik4
Name: glutamate receptor, ionotropic, kainate 4
Synonyms: KA1, 6330551K01Rik, GluRgamma1, KA-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110637
HGNC: HGNC:4582
Homologene: 81829
Gzf1
Name: GDNF-inducible zinc finger protein 1
Synonyms: 8430437G08Rik, Zfp336
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74533
Homologene: 11200
Usp42
Name: ubiquitin specific peptidase 42
Synonyms: 3110031A07Rik, 2410140K03Rik, D5Ertd591e, A630018G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 76800
Homologene: 35425
Wdr6
Name: WD repeat domain 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 83669
Homologene: 117682
Brd9
Name: bromodomain containing 9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105246
VEGA: 13
Homologene: 82462
Ehbp1
Name: EH domain binding protein 1
Synonyms: Flj21950, KIAA0903-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216565
Homologene: 22880
Zfp345
Name: zinc finger protein 345
Synonyms: OTTMUSG00000015743
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 545471
Homologene: 134546
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Wdr72
Name: WD repeat domain 72
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 546144
Homologene: 52326
Abcb4
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 4
Synonyms: mdr-2, Mdr2, Pgy-2, Pgy2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18670
HGNC: HGNC:45
Homologene: 136368
Fam184b
Name: family with sequence similarity 184, member B
Synonyms: 9630031F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 58227
Homologene: 137353
Atp1a3
Name: ATPase, Na+/K+ transporting, alpha 3 polypeptide
Synonyms: Atpa-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232975
HGNC: HGNC:801
Homologene: 113729
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Zhx2
Name: zinc fingers and homeoboxes 2
Synonyms: Raf, Afr-1, Afr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 387609
Homologene: 8968
Ptpdc1
Name: protein tyrosine phosphatase domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218232
VEGA: 13
Homologene: 17576
Gvin3
Name: GTPase, very large interferon inducible, family member 3
Synonyms: Gm1966
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 434223
Homologene: 32708
Gm6614
Name: predicted gene 6614
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 625716
Homologene: 87075
Kif21a
Name: kinesin family member 21A
Synonyms: N-5 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16564
VEGA: 15
Homologene: 56761
Adrb2
Name: adrenergic receptor, beta 2
Synonyms: beta 2-AR, Badm, Adrb-2, beta 2-adrenoceptor, Gpcr7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 11555
VEGA: 18
HGNC: HGNC:286
Homologene: 30948
Phlpp2
Name: PH domain and leucine rich repeat protein phosphatase 2
Synonyms: C130044A18Rik, Phlppl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244650
Homologene: 71015
Ccm2l
Name: cerebral cavernous malformation 2-like
Synonyms: BC020535
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228788
Homologene: 130991
Tmem132d
Name: transmembrane protein 132D
Synonyms: C630028F04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243274
Homologene: 71684
Cyp2c37
Name: cytochrome P450, family 2. subfamily c, polypeptide 37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13096
Homologene: 137231
Vmn2r92
Name: vomeronasal 2, receptor 92
Synonyms: EG627111
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 627111
Homologene: 115024
Tmf1
Name: TATA element modulatory factor 1
Synonyms: LOC232286, 7030402D04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232286
Homologene: 133801
Pgbd1
Name: piggyBac transposable element derived 1
Synonyms: 4921509E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 319207
Homologene: 130030
Prex1
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
Synonyms: P-REX1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 277360
Homologene: 10821
Ccdc149
Name: coiled-coil domain containing 149
Synonyms: LOC242997, Gm447
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100503884
Homologene: 65264
Adam6b
Name: a disintegrin and metallopeptidase domain 6B
Synonyms: 4930523C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238405
Homologene: 128362
Tiam2
Name: T cell lymphoma invasion and metastasis 2
Synonyms: STEF, 3000002F19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 24001
VEGA: 17
Homologene: 40796
Atp8a2
Name: ATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonyms: Ib, wl, agil
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 108168164
Homologene: 4443
Zc3h6
Name: zinc finger CCCH type containing 6
Synonyms: 4631426G04Rik, 4833425H18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 78751
Homologene: 35328
Emilin3
Name: elastin microfibril interfacer 3
Synonyms: Emilin5, 1110013O17Rik, EMILIN-T
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 280635
Homologene: 18817
Ggt1
Name: gamma-glutamyltransferase 1
Synonyms: GGT, CD224, Ggtp, dwg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 14598
Homologene: 68450
Lrrc45
Name: leucine rich repeat containing 45
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217366
Homologene: 17019
Nck2
Name: non-catalytic region of tyrosine kinase adaptor protein 2
Synonyms: NCKbeta, Grb4, 4833426I10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17974
HGNC: HGNC:7665
Homologene: 20794
Hhat
Name: hedgehog acyltransferase
Synonyms: Skn, 2810432O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226861
Homologene: 41232
Wee2
Name: WEE1 homolog 2 (S. pombe)
Synonyms: LOC381759, Wee1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 381759
Homologene: 52392
Ankrd53
Name: ankyrin repeat domain 53
Synonyms: 4930564N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 75305
Homologene: 49810
Obox1
Name: oocyte specific homeobox 1
Synonyms: 7420700M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71468
Homologene: 44937
Gm6434
Name: predicted gene 6434
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101055953
Tm2d2
Name: TM2 domain containing 2
Synonyms: 2410018G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 69742
Homologene: 12328
BC048562
Name: cDNA sequence BC048562
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 434439
Homologene: 79041
Eya4
Name: EYA transcriptional coactivator and phosphatase 4
Synonyms: B130023L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 14051
VEGA: 10
HGNC: HGNC:3522
Homologene: 3025
Tle6
Name: transducin-like enhancer of split 6
Synonyms: Grg6, 1810057E06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 114606
Homologene: 11701
Btnl10
Name: butyrophilin-like 10
Synonyms: BUTR-1, Butr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192194
Homologene: 138184
Hcn1
Name: hyperpolarization activated cyclic nucleotide gated potassium channel 1
Synonyms: HAC2, Bcng1, C630013B14Rik, hyperpolarization-activated, cyclic nucleotide-gated K+ 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 15165
HGNC: HGNC:4845
Homologene: 32093
Fgf12
Name: fibroblast growth factor 12
Synonyms: Fhf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 14167
VEGA: 16
HGNC: HGNC:3668
Homologene: 10874
Synpo
Name: synaptopodin
Synonyms: 9330140I15Rik, 9030217H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 104027
Homologene: 5274
Ms4a5
Name: membrane-spanning 4-domains, subfamily A, member 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 269063
Homologene: 11404
Ifit1bl1
Name: interferon induced protein with tetratricpeptide repeats 1B like 1
Synonyms: Gm14446
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 667373
Homologene: 78213
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 43,554,118 bp
  • T to G, chromosome 1 at 132,493,844 bp
  • C to T, chromosome 1 at 192,552,934 bp
  • C to T, chromosome 2 at 127,049,360 bp
  • A to G, chromosome 2 at 129,014,827 bp
  • A to G, chromosome 2 at 148,683,833 bp
  • G to A, chromosome 2 at 150,473,243 bp
  • A to T, chromosome 2 at 153,070,862 bp
  • A to G, chromosome 2 at 160,910,879 bp
  • T to A, chromosome 2 at 166,589,571 bp
  • A to T, chromosome 3 at 30,607,459 bp
  • T to A, chromosome 3 at 95,470,394 bp
  • A to G, chromosome 3 at 113,621,869 bp
  • T to C, chromosome 4 at 64,000,159 bp
  • T to C, chromosome 5 at 8,941,050 bp
  • A to G, chromosome 5 at 45,584,512 bp
  • A to G, chromosome 5 at 52,400,239 bp
  • T to A, chromosome 5 at 73,313,429 bp
  • A to T, chromosome 5 at 113,263,759 bp
  • T to G, chromosome 5 at 127,864,646 bp
  • G to A, chromosome 5 at 143,714,861 bp
  • T to C, chromosome 6 at 40,456,995 bp
  • T to C, chromosome 6 at 83,752,844 bp
  • A to T, chromosome 6 at 83,763,692 bp
  • A to G, chromosome 6 at 97,176,141 bp
  • T to C, chromosome 6 at 113,536,979 bp
  • T to G, chromosome 6 at 141,985,477 bp
  • T to G, chromosome 7 at 15,556,253 bp
  • C to T, chromosome 7 at 24,980,627 bp
  • T to A, chromosome 7 at 25,882,361 bp
  • T to A, chromosome 7 at 28,317,329 bp
  • T to C, chromosome 7 at 96,873,766 bp
  • A to T, chromosome 7 at 104,840,539 bp
  • T to A, chromosome 7 at 106,603,883 bp
  • T to G, chromosome 8 at 25,018,114 bp
  • T to C, chromosome 8 at 107,367,461 bp
  • T to C, chromosome 8 at 109,939,935 bp
  • A to T, chromosome 9 at 42,622,096 bp
  • T to A, chromosome 9 at 74,210,757 bp
  • T to A, chromosome 9 at 99,875,122 bp
  • A to T, chromosome 9 at 108,445,966 bp
  • C to T, chromosome 9 at 108,573,101 bp
  • T to C, chromosome 10 at 23,155,963 bp
  • T to C, chromosome 10 at 53,548,527 bp
  • T to A, chromosome 10 at 75,576,213 bp
  • T to C, chromosome 10 at 81,595,311 bp
  • T to A, chromosome 11 at 21,311,071 bp
  • T to A, chromosome 11 at 22,151,836 bp
  • A to G, chromosome 11 at 36,207,124 bp
  • A to T, chromosome 11 at 58,923,451 bp
  • C to T, chromosome 11 at 87,240,614 bp
  • A to G, chromosome 11 at 118,039,939 bp
  • A to C, chromosome 11 at 120,715,219 bp
  • A to T, chromosome 12 at 113,489,994 bp
  • A to T, chromosome 13 at 21,423,166 bp
  • C to A, chromosome 13 at 48,589,119 bp
  • A to G, chromosome 13 at 73,955,473 bp
  • T to C, chromosome 13 at 117,975,375 bp
  • T to A, chromosome 14 at 12,491,800 bp
  • G to T, chromosome 14 at 59,773,744 bp
  • CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
  • A to G, chromosome 15 at 57,821,840 bp
  • T to C, chromosome 15 at 90,968,054 bp
  • A to G, chromosome 15 at 98,571,094 bp
  • A to T, chromosome 16 at 28,162,529 bp
  • A to G, chromosome 17 at 3,502,918 bp
  • T to G, chromosome 17 at 18,168,921 bp
  • A to G, chromosome 17 at 37,046,762 bp
  • A to G, chromosome 18 at 60,602,418 bp
  • T to A, chromosome 18 at 62,179,539 bp
  • A to G, chromosome 18 at 67,813,893 bp
  • A to G, chromosome 19 at 11,283,654 bp
  • T to C, chromosome 19 at 34,594,514 bp
  • A to C, chromosome 19 at 39,995,794 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0420 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038622-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.