Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0420Btlr/Mmmh
Stock Number:
038622-MU
Citation ID:
RRID:MMRRC_038622-MU
Other Names:
R0420 (G1), C57BL/6J-MtgxR0420Btlr
Major Collection:

Strain Information

Nfat5
Name: nuclear factor of activated T cells 5
Synonyms: nfatz, TonEBP, B130038B15Rik, OREBP
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54446
HGNC: HGNC:7774
Homologene: 4811
Ap4e1
Name: adaptor-related protein complex AP-4, epsilon 1
Synonyms: 2310033A20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108011
HGNC: HGNC:573
Homologene: 22397
Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Spmip11
Name: sperm microtubule inner protein 11
Synonyms: 4930415O20Rik, Tex49
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73863
VEGA: 15
Homologene: 19174
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 43,554,118 bp
  • T to G, chromosome 1 at 132,493,844 bp
  • C to T, chromosome 1 at 192,552,934 bp
  • C to T, chromosome 2 at 127,049,360 bp
  • A to G, chromosome 2 at 129,014,827 bp
  • A to G, chromosome 2 at 148,683,833 bp
  • G to A, chromosome 2 at 150,473,243 bp
  • A to T, chromosome 2 at 153,070,862 bp
  • A to G, chromosome 2 at 160,910,879 bp
  • T to A, chromosome 2 at 166,589,571 bp
  • A to T, chromosome 3 at 30,607,459 bp
  • T to A, chromosome 3 at 95,470,394 bp
  • A to G, chromosome 3 at 113,621,869 bp
  • T to C, chromosome 4 at 64,000,159 bp
  • T to C, chromosome 5 at 8,941,050 bp
  • A to G, chromosome 5 at 45,584,512 bp
  • A to G, chromosome 5 at 52,400,239 bp
  • T to A, chromosome 5 at 73,313,429 bp
  • A to T, chromosome 5 at 113,263,759 bp
  • T to G, chromosome 5 at 127,864,646 bp
  • G to A, chromosome 5 at 143,714,861 bp
  • T to C, chromosome 6 at 40,456,995 bp
  • T to C, chromosome 6 at 83,752,844 bp
  • A to T, chromosome 6 at 83,763,692 bp
  • A to G, chromosome 6 at 97,176,141 bp
  • T to C, chromosome 6 at 113,536,979 bp
  • T to G, chromosome 6 at 141,985,477 bp
  • T to G, chromosome 7 at 15,556,253 bp
  • C to T, chromosome 7 at 24,980,627 bp
  • T to A, chromosome 7 at 25,882,361 bp
  • T to A, chromosome 7 at 28,317,329 bp
  • T to C, chromosome 7 at 96,873,766 bp
  • A to T, chromosome 7 at 104,840,539 bp
  • T to A, chromosome 7 at 106,603,883 bp
  • T to G, chromosome 8 at 25,018,114 bp
  • T to C, chromosome 8 at 107,367,461 bp
  • T to C, chromosome 8 at 109,939,935 bp
  • A to T, chromosome 9 at 42,622,096 bp
  • T to A, chromosome 9 at 74,210,757 bp
  • T to A, chromosome 9 at 99,875,122 bp
  • A to T, chromosome 9 at 108,445,966 bp
  • C to T, chromosome 9 at 108,573,101 bp
  • T to C, chromosome 10 at 23,155,963 bp
  • T to C, chromosome 10 at 53,548,527 bp
  • T to A, chromosome 10 at 75,576,213 bp
  • T to C, chromosome 10 at 81,595,311 bp
  • T to A, chromosome 11 at 21,311,071 bp
  • T to A, chromosome 11 at 22,151,836 bp
  • A to G, chromosome 11 at 36,207,124 bp
  • A to T, chromosome 11 at 58,923,451 bp
  • C to T, chromosome 11 at 87,240,614 bp
  • A to G, chromosome 11 at 118,039,939 bp
  • A to C, chromosome 11 at 120,715,219 bp
  • A to T, chromosome 12 at 113,489,994 bp
  • A to T, chromosome 13 at 21,423,166 bp
  • C to A, chromosome 13 at 48,589,119 bp
  • A to G, chromosome 13 at 73,955,473 bp
  • T to C, chromosome 13 at 117,975,375 bp
  • T to A, chromosome 14 at 12,491,800 bp
  • G to T, chromosome 14 at 59,773,744 bp
  • CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
  • A to G, chromosome 15 at 57,821,840 bp
  • T to C, chromosome 15 at 90,968,054 bp
  • A to G, chromosome 15 at 98,571,094 bp
  • A to T, chromosome 16 at 28,162,529 bp
  • A to G, chromosome 17 at 3,502,918 bp
  • T to G, chromosome 17 at 18,168,921 bp
  • A to G, chromosome 17 at 37,046,762 bp
  • A to G, chromosome 18 at 60,602,418 bp
  • T to A, chromosome 18 at 62,179,539 bp
  • A to G, chromosome 18 at 67,813,893 bp
  • A to G, chromosome 19 at 11,283,654 bp
  • T to C, chromosome 19 at 34,594,514 bp
  • A to C, chromosome 19 at 39,995,794 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0420 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038622-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.