Strain Name:
C57BL/6J-MtgxR0501Btlr/Mmmh
Stock Number:
038696-MU
Citation ID:
RRID:MMRRC_038696-MU
Other Names:
R0501 (G1), C57BL/6J-MtgxR0501Btlr
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: A230020K14Rik, N-CoR, 5730405M06Rik, Rxrip13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: MYH-beta/slow, MyHC-I, betaMHC, Myhc-b, B-MHC, beta-MHC, Myhcb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: alpha13.2, T-type Cav3.2, Cav3.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Adcy10
Name: adenylate cyclase 10
Synonyms: 4930431D04Rik, soluble adenylyl cyclase, Sacy, sAC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 271639
Homologene: 10188
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Top1
Name: topoisomerase (DNA) I
Synonyms: Top-1, D130064I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 21969
Homologene: 2467
Wnk1
Name: WNK lysine deficient protein kinase 1
Synonyms: Hsn2, EG406236, Prkwnk1, 6430573H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232341
Homologene: 14253
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Wdr59
Name: WD repeat domain 59
Synonyms: 5430401O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 319481
Homologene: 38685
Ythdf3
Name: YTH N6-methyladenosine RNA binding protein 3
Synonyms: 9130022A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229096
Homologene: 34991
Fcho2
Name: FCH domain only 2
Synonyms: 5832424M12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218503
VEGA: 13
Homologene: 9030
Supt20
Name: SPT20 SAGA complex component
Synonyms: p38 interacting protein, D3Ertd300e, p38IP, Fam48a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 56790
Homologene: 134155
Setdb1
Name: SET domain, bifurcated 1
Synonyms: KMT1E, ESET
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 84505
Homologene: 32157
Akap9
Name: A kinase (PRKA) anchor protein (yotiao) 9
Synonyms: repro12, G1-448-15, mei2-5, 5730481H23Rik, AKAP450
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Skic3
Name: SKI3 subunit of superkiller complex
Synonyms: Ttc37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218343
VEGA: 13
Homologene: 40966
Cntrob
Name: centrobin, centrosomal BRCA2 interacting protein
Synonyms: Lip8, Nip2, 9830165K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216846
Homologene: 14205
Nsmaf
Name: neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms: Fan, factor associated with N-SMase activation
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18201
HGNC: HGNC:8017
Homologene: 2652
Mbnl1
Name: muscleblind like splicing regulator 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 56758
HGNC: HGNC:6923
Homologene: 23186
Ckap2l
Name: cytoskeleton associated protein 2-like
Synonyms: Radmis, 2610318C08Rik, 2010016H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 70466
Homologene: 51866
Hsph1
Name: heat shock 105kDa/110kDa protein 1
Synonyms: hsp110/105, HSP110, Hsp105, hsp-E7I
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 15505
Homologene: 21322
Fcho1
Name: FCH domain only 1
Synonyms: 3322402E17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 74015
Homologene: 22869
Chst3
Name: carbohydrate sulfotransferase 3
Synonyms: C6ST-1, GST-0, C6ST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 53374
HGNC: HGNC:1971
Homologene: 3156
Rbms2
Name: RNA binding motif, single stranded interacting protein 2
Synonyms: 2610315E04Rik, Scr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 56516
VEGA: 10
HGNC: HGNC:9909
Homologene: 37706
Ndel1
Name: nudE neurodevelopment protein 1 like 1
Synonyms: mNudel, 2600006O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83431
Homologene: 32567
Rbm15
Name: RNA binding motif protein 15
Synonyms: C230088J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229700
Homologene: 23383
Pdia4
Name: protein disulfide isomerase associated 4
Synonyms: ERp72, Erp72, Cai, U48620
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12304
Homologene: 21020
Tes
Name: testin LIM domain protein
Synonyms: Tes1, D6Ertd352e, testin, testin2, Tes2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21753
Homologene: 41051
Adam19
Name: a disintegrin and metallopeptidase domain 19 (meltrin beta)
Synonyms: Mltnb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11492
HGNC: HGNC:197
Homologene: 74925
Mcm6
Name: minichromosome maintenance complex component 6
Synonyms: D1Wsu22e, Mcmd6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17219
HGNC: HGNC:6949
Homologene: 4322
Nid2
Name: nidogen 2
Synonyms: entactin 2, entactin-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 18074
VEGA: 14
Homologene: 40575
Stk11
Name: serine/threonine kinase 11
Synonyms: Par-4, Lkb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 20869
Homologene: 393
Nolc1
Name: nucleolar and coiled-body phosphoprotein 1
Synonyms: NOPP140, 3230402K17Rik, P130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 70769
VEGA: 19
Mtmr4
Name: myotubularin related protein 4
Synonyms: FYVE-DSP2, FYVE zinc finger phosphatase, ZFYVE11, ESTM44
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 170749
HGNC: HGNC:7452
Homologene: 3440
Zcchc2
Name: zinc finger, CCHC domain containing 2
Synonyms: 9930114B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227449
Homologene: 9808
Wdtc1
Name: WD and tetratricopeptide repeats 1
Synonyms: adipose, adp, LOC230796
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230796
Homologene: 8997
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Itpr-3, Ip3r3, tf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 94109
Homologene: 69536
Pcgf3
Name: polycomb group ring finger 3
Synonyms: Rnf3, RNF3A, D630042K08Rik, DONG1, 2310035N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 69587
Homologene: 4605
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Ttn
Name: titin
Synonyms: L56, mdm, D830007G01Rik, 2310074I15Rik, shru, 2310036G12Rik, connectin, D330041I19Rik, 2310057K23Rik, 1100001C23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Avl9
Name: AVL9 cell migration associated
Synonyms: D730049P16Rik, 5830411G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 78937
Homologene: 62425
Car4
Name: carbonic anhydrase 4
Synonyms: CA IV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12351
HGNC: HGNC:1375
Homologene: 20183
Tbx19
Name: T-box 19
Synonyms: Tpit, D1Ertd754e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 83993
Homologene: 3779
Insrr
Name: insulin receptor-related receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23920
HGNC: HGNC:6093
Homologene: 56539
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: Mgr1, Gpr98, VLGR1, Mass1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 110789
Homologene: 19815
Trim45
Name: tripartite motif-containing 45
Synonyms: 4921530N01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229644
Homologene: 11865
Kif1a
Name: kinesin family member 1A
Synonyms: ATSV, Kns1, LOC381283, N-3 kinesin, C630002N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16560
HGNC: HGNC:888
Homologene: 99729
Tmem132e
Name: transmembrane protein 132E
Synonyms: LOC270893
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 270893
Homologene: 41524
Adamts2
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2
Synonyms: hPCPNI, procollagen N-proteinase, a disintegrin and metalloproteinase with thrombospondin repeats, ADAM-TS2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216725
HGNC: HGNC:218
Homologene: 8597
Dmac1
Name: distal membrane arm assembly complex 1
Synonyms: Tmem261, 1700027K24Rik, 3110001D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66928
Homologene: 12054
Fmo2
Name: flavin containing monooxygenase 2
Synonyms: 2310008D08Rik, 2310042I22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 55990
HGNC: HGNC:3770
Homologene: 86882
Dpp6
Name: dipeptidylpeptidase 6
Synonyms: In(5)6H-p, Rw, Dpp-6, B930011P16Rik, LOC384168, Peplb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13483
HGNC: HGNC:3010
Homologene: 22560
Or10ak14
Name: olfactory receptor family 10 subfamily AK member 14
Synonyms: MOR259-4P, GA_x6K02T2QD9B-18795136-18796077, MOR259-9, Olfr1338, Olfr1524-ps1, MOR259-4P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 258259
Homologene: 115537
Irs2
Name: insulin receptor substrate 2
Synonyms: Irs-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 384783
HGNC: HGNC:6126
Homologene: 2778
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: mSlo1, MaxiK, BK channel alpha subunit, Slo, 5730414M22Rik, BKCa, Slo1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
4932425I24Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Cntn4
Name: contactin 4
Synonyms: BIG-2A, Axcam
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 269784
HGNC: HGNC:2174
Homologene: 14257
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 628870
Homologene: 46008
Or13e8
Name: olfactory receptor family 13 subfamily E member 8
Synonyms: mOR6, MOR262-10, Olfr70, GA_x6K02T2N78B-16239704-16240654
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56014
Homologene: 10459
Twnk
Name: twinkle mtDNA helicase
Synonyms: Peo1, D19Ertd626e, Twinl, twinkle
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226153
VEGA: 19
HGNC: HGNC:1160
Homologene: 11052
Or4e1
Name: olfactory receptor family 4 subfamily E member 1
Synonyms: GA_x6K02T2RJGY-520647-521579, Olfr1508, MOR244-2, MOR10, MOR244-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 57270
HGNC: HGNC:8296
Homologene: 10737
Sdk1
Name: sidekick cell adhesion molecule 1
Synonyms: 6720466O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 330222
Homologene: 27395
Tph1
Name: tryptophan hydroxylase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21990
Homologene: 121565
Agbl2
Name: ATP/GTP binding protein-like 2
Synonyms: Ccp2, Ccp2, A430081C19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 271813
Homologene: 11715
Kif21b
Name: kinesin family member 21B
Synonyms: 2610511N21Rik, N-5 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16565
Homologene: 56868
Aoah
Name: acyloxyacyl hydrolase
Synonyms: 4930433E13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 27052
VEGA: 13
HGNC: HGNC:548
Homologene: 1238
Or5m12
Name: olfactory receptor family 5 subfamily M member 12
Synonyms: Olfr1024, MOR197-1, GA_x6K02T2Q125-47384320-47383337
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 257900
Homologene: 128271
Gm17541
Name: predicted gene, 17541
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 100416664
VEGA: 12
Cpne7
Name: copine VII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102278
HGNC: HGNC:2320
Homologene: 65128
Apc2
Name: APC regulator of WNT signaling pathway 2
Synonyms: APCL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 23805
Homologene: 4299
Scg2
Name: secretogranin II
Synonyms: SgII, Chgc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20254
Homologene: 2591
Or5d14
Name: olfactory receptor family 5 subfamily D member 14
Synonyms: GA_x6K02T2Q125-49542541-49541597, MOR174-14, Olfr1162
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258105
Homologene: 79476
Vmn2r8
Name: vomeronasal 2, receptor 8
Synonyms: EG627479
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 627479
Homologene: 129606
D7Ertd443e
Name: DNA segment, Chr 7, ERATO Doi 443, expressed
Synonyms: 4933400E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71007
Homologene: 18998
Slc22a22
Name: solute carrier family 22 (organic cation transporter), member 22
Synonyms: OAT-PG, BC026439
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 210463
Homologene: 18166
Or4a68
Name: olfactory receptor family 4 subfamily A member 68
Synonyms: MOR231-8, GA_x6K02T2Q125-50883183-50882239, Olfr1240
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258804
Homologene: 121591
1700030K09Rik
Name: RIKEN cDNA 1700030K09 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72254
Homologene: 12975
Bpifa5
Name: BPI fold containing family A, member 5
Synonyms: 2310074B19Rik, 2310021H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67135
Homologene: 12087
C230029F24Rik
Name: RIKEN cDNA C230029F24 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 442837
Or1j1
Name: olfactory receptor family 1 subfamily J member 1
Synonyms: Olfr3, Y71, MOR136-14, GA_x6K02T2NLDC-33507606-33506665
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18328
HGNC: HGNC:8208
Homologene: 66579
Or12e9
Name: olfactory receptor family 12 subfamily E member 9
Synonyms: MOR264-18, GA_x6K02T2Q125-48863863-48864807, Olfr1121
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258345
Homologene: 74084
Fabp12
Name: fatty acid binding protein 12
Synonyms: 1700008G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 75497
Homologene: 67746
Toe1
Name: target of EGR1, member 1 (nuclear)
Synonyms: 4933424D16Rik, 4930584N22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68276
Homologene: 11823
Tmem214
Name: transmembrane protein 214
Synonyms: 1110039B18Rik, 4921530J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 68796
Homologene: 9801
Igkv4-71
Name: immunoglobulin kappa chain variable 4-71
Synonyms: Gm16730
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 434586
Or2ag13
Name: olfactory receptor family 2 subfamily AG member 13
Synonyms: GA_x6K02T2PBJ9-9092181-9091234, MOR283-6, Olfr695
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258591
Homologene: 133597
Or2ag18
Name: olfactory receptor family 2 subfamily AG member 18
Synonyms: GA_x6K02T2PBJ9-9184187-9183237, MOR283-4, Olfr700
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258593
Homologene: 64895
Or10a5
Name: olfactory receptor family 10 subfamily A member 5
Synonyms: MOR263-1, Olfr713, GA_x6K02T2PBJ9-9415724-9416677, P3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259036
Homologene: 17470
Gm4353
Name: predicted gene 4353
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100043313
VEGA: 7
Or7g35
Name: olfactory receptor family 7 subfamily G member 35
Synonyms: Olfr855, MOR148-1, GA_x6K02T2PVTD-13330461-13331399
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258517
HGNC: HGNC:8466
Homologene: 74176
Creb3l3
Name: cAMP responsive element binding protein 3-like 3
Synonyms: D10Bur1e, CREB-H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 208677
Homologene: 13080
Ube2z
Name: ubiquitin-conjugating enzyme E2Z
Synonyms: C030047H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268470
Homologene: 11319
Wdr20rt
Name: WD repeat domain 20, retrogene
Synonyms: Wdr20b, 4921538B03Rik, 4930427E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 70948
VEGA: 12
Tmem253
Name: transmembrane protein 253
Synonyms: G630016D24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 619301
VEGA: 14
Homologene: 83921
Rsph3a
Name: radial spoke 3A homolog (Chlamydomonas)
Synonyms: 4930524H12Rik, 1700012G05Rik, Rshl2a, Rshl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 66832
VEGA: 17
Homologene: 12043
Mapk13
Name: mitogen-activated protein kinase 13
Synonyms: Serk4, SAPK4, p38 delta MAP kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 26415
HGNC: HGNC:6875
Homologene: 48133
Mbp
Name: myelin basic protein
Synonyms: Hmbpr, jve, golli-mbp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17196
HGNC: HGNC:6925
Homologene: 1788
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 49,335,470 bp
  • G to C, chromosome 1 at 79,435,603 bp
  • G to A, chromosome 1 at 93,056,245 bp
  • T to G, chromosome 1 at 106,016,091 bp
  • A to G, chromosome 1 at 128,355,636 bp
  • A to T, chromosome 1 at 136,163,099 bp
  • A to G, chromosome 1 at 162,876,928 bp
  • C to T, chromosome 1 at 165,153,455 bp
  • C to T, chromosome 1 at 165,510,390 bp
  • A to T, chromosome 2 at 36,812,480 bp
  • T to A, chromosome 2 at 76,944,174 bp
  • A to G, chromosome 2 at 85,905,004 bp
  • A to T, chromosome 2 at 87,371,552 bp
  • A to T, chromosome 2 at 88,050,471 bp
  • T to C, chromosome 2 at 89,439,716 bp
  • A to T, chromosome 2 at 90,793,859 bp
  • G to A, chromosome 2 at 125,301,749 bp
  • G to A, chromosome 2 at 129,285,491 bp
  • A to T, chromosome 2 at 154,163,696 bp
  • C to A, chromosome 2 at 160,714,159 bp
  • T to C, chromosome 3 at 10,250,143 bp
  • T to C, chromosome 3 at 16,205,072 bp
  • A to G, chromosome 3 at 54,703,183 bp
  • C to T, chromosome 3 at 60,622,254 bp
  • G to T, chromosome 3 at 87,810,684 bp
  • A to G, chromosome 3 at 95,338,829 bp
  • T to A, chromosome 3 at 100,923,219 bp
  • G to T, chromosome 3 at 107,332,530 bp
  • A to T, chromosome 4 at 6,437,935 bp
  • A to C, chromosome 4 at 43,697,079 bp
  • T to G, chromosome 4 at 75,278,176 bp
  • A to G, chromosome 4 at 116,807,485 bp
  • C to A, chromosome 4 at 118,753,830 bp
  • A to G, chromosome 4 at 133,308,840 bp
  • T to C, chromosome 5 at 3,970,685 bp
  • T to A, chromosome 5 at 27,725,606 bp
  • G to T, chromosome 5 at 30,872,532 bp
  • T to A, chromosome 5 at 108,475,112 bp
  • T to C, chromosome 5 at 108,803,183 bp
  • A to T, chromosome 5 at 141,937,718 bp
  • T to C, chromosome 5 at 149,632,021 bp
  • G to A, chromosome 6 at 17,097,558 bp
  • A to T, chromosome 6 at 47,801,002 bp
  • T to A, chromosome 6 at 56,735,350 bp
  • A to T, chromosome 6 at 69,243,306 bp
  • A to G, chromosome 6 at 84,087,884 bp
  • A to T, chromosome 6 at 106,618,335 bp
  • C to T, chromosome 6 at 119,962,803 bp
  • G to T, chromosome 7 at 46,649,988 bp
  • A to T, chromosome 7 at 106,714,603 bp
  • G to A, chromosome 7 at 106,805,811 bp
  • A to T, chromosome 7 at 107,036,232 bp
  • A to T, chromosome 7 at 116,083,471 bp
  • C to A, chromosome 7 at 116,354,055 bp
  • G to A, chromosome 7 at 134,294,972 bp
  • C to T, chromosome 8 at 11,006,396 bp
  • T to A, chromosome 8 at 17,027,323 bp
  • C to T, chromosome 8 at 71,712,560 bp
  • T to C, chromosome 8 at 72,455,372 bp
  • C to T, chromosome 8 at 111,458,947 bp
  • T to A, chromosome 8 at 123,126,255 bp
  • T to A, chromosome 9 at 19,584,618 bp
  • A to G, chromosome 10 at 60,186,227 bp
  • C to A, chromosome 10 at 80,126,285 bp
  • T to C, chromosome 10 at 80,315,124 bp
  • C to A, chromosome 10 at 81,086,582 bp
  • T to C, chromosome 10 at 107,819,929 bp
  • G to A, chromosome 10 at 128,137,710 bp
  • C to T, chromosome 11 at 46,123,130 bp
  • A to G, chromosome 11 at 50,668,145 bp
  • T to A, chromosome 11 at 62,373,322 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • G to A, chromosome 11 at 69,322,868 bp
  • T to A, chromosome 11 at 82,435,068 bp
  • G to A, chromosome 11 at 84,963,442 bp
  • G to A, chromosome 11 at 87,613,537 bp
  • A to G, chromosome 11 at 96,050,288 bp
  • T to G, chromosome 12 at 4,689,730 bp
  • A to T, chromosome 12 at 65,225,807 bp
  • A to G, chromosome 13 at 21,005,073 bp
  • A to C, chromosome 13 at 76,147,806 bp
  • T to C, chromosome 13 at 81,559,150 bp
  • A to T, chromosome 13 at 98,764,515 bp
  • T to A, chromosome 14 at 19,789,668 bp
  • T to C, chromosome 14 at 23,311,716 bp
  • T to A, chromosome 14 at 52,018,579 bp
  • T to A, chromosome 14 at 52,463,926 bp
  • T to G, chromosome 14 at 54,986,447 bp
  • T to A, chromosome 15 at 57,249,650 bp
  • C to G, chromosome 16 at 38,335,635 bp
  • T to C, chromosome 16 at 93,752,862 bp
  • T to A, chromosome 17 at 7,979,120 bp
  • A to T, chromosome 17 at 25,388,667 bp
  • T to A, chromosome 17 at 27,107,289 bp
  • G to A, chromosome 17 at 28,776,353 bp
  • C to T, chromosome 18 at 82,575,197 bp
  • T to C, chromosome 19 at 45,007,746 bp
  • T to C, chromosome 19 at 46,078,920 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0501 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038696-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.