Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0501Btlr/Mmmh
Stock Number:
038696-MU
Citation ID:
RRID:MMRRC_038696-MU
Other Names:
R0501 (G1), C57BL/6J-MtgxR0501Btlr
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: alpha13.2, Cav3.2, T-type Cav3.2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Adcy10
Name: adenylate cyclase 10
Synonyms: soluble adenylyl cyclase, sAC, 4930431D04Rik, Sacy
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 271639
Homologene: 10188
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Top1
Name: topoisomerase (DNA) I
Synonyms: Top-1, D130064I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21969
Homologene: 2467
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 49,335,470 bp
  • G to C, chromosome 1 at 79,435,603 bp
  • G to A, chromosome 1 at 93,056,245 bp
  • T to G, chromosome 1 at 106,016,091 bp
  • A to G, chromosome 1 at 128,355,636 bp
  • A to T, chromosome 1 at 136,163,099 bp
  • A to G, chromosome 1 at 162,876,928 bp
  • C to T, chromosome 1 at 165,153,455 bp
  • C to T, chromosome 1 at 165,510,390 bp
  • A to T, chromosome 2 at 36,812,480 bp
  • T to A, chromosome 2 at 76,944,174 bp
  • A to G, chromosome 2 at 85,905,004 bp
  • A to T, chromosome 2 at 87,371,552 bp
  • A to T, chromosome 2 at 88,050,471 bp
  • T to C, chromosome 2 at 89,439,716 bp
  • A to T, chromosome 2 at 90,793,859 bp
  • G to A, chromosome 2 at 125,301,749 bp
  • G to A, chromosome 2 at 129,285,491 bp
  • A to T, chromosome 2 at 154,163,696 bp
  • C to A, chromosome 2 at 160,714,159 bp
  • T to C, chromosome 3 at 10,250,143 bp
  • T to C, chromosome 3 at 16,205,072 bp
  • A to G, chromosome 3 at 54,703,183 bp
  • C to T, chromosome 3 at 60,622,254 bp
  • G to T, chromosome 3 at 87,810,684 bp
  • A to G, chromosome 3 at 95,338,829 bp
  • T to A, chromosome 3 at 100,923,219 bp
  • G to T, chromosome 3 at 107,332,530 bp
  • A to T, chromosome 4 at 6,437,935 bp
  • A to C, chromosome 4 at 43,697,079 bp
  • T to G, chromosome 4 at 75,278,176 bp
  • A to G, chromosome 4 at 116,807,485 bp
  • C to A, chromosome 4 at 118,753,830 bp
  • A to G, chromosome 4 at 133,308,840 bp
  • T to C, chromosome 5 at 3,970,685 bp
  • T to A, chromosome 5 at 27,725,606 bp
  • G to T, chromosome 5 at 30,872,532 bp
  • T to A, chromosome 5 at 108,475,112 bp
  • T to C, chromosome 5 at 108,803,183 bp
  • A to T, chromosome 5 at 141,937,718 bp
  • T to C, chromosome 5 at 149,632,021 bp
  • G to A, chromosome 6 at 17,097,558 bp
  • A to T, chromosome 6 at 47,801,002 bp
  • T to A, chromosome 6 at 56,735,350 bp
  • A to T, chromosome 6 at 69,243,306 bp
  • A to G, chromosome 6 at 84,087,884 bp
  • A to T, chromosome 6 at 106,618,335 bp
  • C to T, chromosome 6 at 119,962,803 bp
  • G to T, chromosome 7 at 46,649,988 bp
  • A to T, chromosome 7 at 106,714,603 bp
  • G to A, chromosome 7 at 106,805,811 bp
  • A to T, chromosome 7 at 107,036,232 bp
  • A to T, chromosome 7 at 116,083,471 bp
  • C to A, chromosome 7 at 116,354,055 bp
  • G to A, chromosome 7 at 134,294,972 bp
  • C to T, chromosome 8 at 11,006,396 bp
  • T to A, chromosome 8 at 17,027,323 bp
  • C to T, chromosome 8 at 71,712,560 bp
  • T to C, chromosome 8 at 72,455,372 bp
  • C to T, chromosome 8 at 111,458,947 bp
  • T to A, chromosome 8 at 123,126,255 bp
  • T to A, chromosome 9 at 19,584,618 bp
  • A to G, chromosome 10 at 60,186,227 bp
  • C to A, chromosome 10 at 80,126,285 bp
  • T to C, chromosome 10 at 80,315,124 bp
  • C to A, chromosome 10 at 81,086,582 bp
  • T to C, chromosome 10 at 107,819,929 bp
  • G to A, chromosome 10 at 128,137,710 bp
  • C to T, chromosome 11 at 46,123,130 bp
  • A to G, chromosome 11 at 50,668,145 bp
  • T to A, chromosome 11 at 62,373,322 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • G to A, chromosome 11 at 69,322,868 bp
  • T to A, chromosome 11 at 82,435,068 bp
  • G to A, chromosome 11 at 84,963,442 bp
  • G to A, chromosome 11 at 87,613,537 bp
  • A to G, chromosome 11 at 96,050,288 bp
  • T to G, chromosome 12 at 4,689,730 bp
  • A to T, chromosome 12 at 65,225,807 bp
  • A to G, chromosome 13 at 21,005,073 bp
  • A to C, chromosome 13 at 76,147,806 bp
  • T to C, chromosome 13 at 81,559,150 bp
  • A to T, chromosome 13 at 98,764,515 bp
  • T to A, chromosome 14 at 19,789,668 bp
  • T to C, chromosome 14 at 23,311,716 bp
  • T to A, chromosome 14 at 52,018,579 bp
  • T to A, chromosome 14 at 52,463,926 bp
  • T to G, chromosome 14 at 54,986,447 bp
  • T to A, chromosome 15 at 57,249,650 bp
  • C to G, chromosome 16 at 38,335,635 bp
  • T to C, chromosome 16 at 93,752,862 bp
  • T to A, chromosome 17 at 7,979,120 bp
  • A to T, chromosome 17 at 25,388,667 bp
  • T to A, chromosome 17 at 27,107,289 bp
  • G to A, chromosome 17 at 28,776,353 bp
  • C to T, chromosome 18 at 82,575,197 bp
  • T to C, chromosome 19 at 45,007,746 bp
  • T to C, chromosome 19 at 46,078,920 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0501 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038696-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.