Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0520Btlr/Mmmh
Stock Number:
038713-MU
Citation ID:
RRID:MMRRC_038713-MU
Other Names:
R0520 (G1), C57BL/6J-MtgxR0520Btlr
Major Collection:

Strain Information

Inpp5d
Name: inositol polyphosphate-5-phosphatase D
Synonyms: SHIP, Src homology 2 domain-containing inositol-5-phosphatase, s-SHIP, SHIP-1, SHIP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16331
HGNC: HGNC:6079
Homologene: 4046
Gnai2
Name: G protein subunit alpha i2
Synonyms: Gia, Gnai-2, Galphai2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14678
HGNC: HGNC:4385
Homologene: 55539
Dclre1c
Name: DNA cross-link repair 1C
Synonyms: 9930121L06Rik, Artemis, Art
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227525
Homologene: 32547
Plekhm1
Name: pleckstrin homology domain containing, family M (with RUN domain) member 1
Synonyms: D330036J23Rik, AP162, B2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 353047
Homologene: 8871
Inpp5k
Name: inositol polyphosphate 5-phosphatase K
Synonyms: C62, PI-5-phosphatase related, putative PI-5-phosphatase, Pps
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19062
Homologene: 75059
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Aff1
Name: AF4/FMR2 family, member 1
Synonyms: Af4, Rob, 9630032B01Rik, Mllt2h
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17355
HGNC: HGNC:7135
Homologene: 4340
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 21,229,412 bp
  • A to G, chromosome 1 at 43,990,530 bp
  • T to G, chromosome 1 at 74,602,206 bp
  • C to T, chromosome 1 at 75,186,534 bp
  • T to C, chromosome 1 at 87,705,920 bp
  • T to A, chromosome 1 at 92,608,749 bp
  • T to A, chromosome 1 at 97,884,195 bp
  • T to A, chromosome 1 at 139,478,820 bp
  • T to G, chromosome 1 at 164,209,587 bp
  • C to T, chromosome 1 at 167,361,391 bp
  • A to G, chromosome 1 at 175,726,392 bp
  • T to A, chromosome 1 at 175,899,465 bp
  • A to G, chromosome 2 at 3,436,475 bp
  • C to T, chromosome 2 at 69,105,091 bp
  • A to C, chromosome 2 at 80,541,530 bp
  • G to T, chromosome 2 at 86,333,131 bp
  • T to C, chromosome 3 at 105,687,376 bp
  • T to A, chromosome 3 at 109,107,230 bp
  • A to T, chromosome 4 at 40,728,072 bp
  • T to A, chromosome 4 at 95,601,103 bp
  • T to G, chromosome 4 at 100,897,703 bp
  • C to T, chromosome 5 at 14,713,830 bp
  • A to G, chromosome 5 at 86,090,964 bp
  • C to T, chromosome 5 at 103,847,751 bp
  • G to T, chromosome 5 at 121,331,707 bp
  • A to G, chromosome 6 at 101,801,579 bp
  • T to C, chromosome 7 at 118,666,576 bp
  • T to A, chromosome 7 at 141,067,373 bp
  • G to A, chromosome 8 at 13,760,569 bp
  • A to G, chromosome 8 at 119,442,508 bp
  • G to A, chromosome 9 at 20,212,495 bp
  • C to A, chromosome 9 at 27,323,250 bp
  • T to C, chromosome 9 at 37,773,553 bp
  • T to C, chromosome 9 at 67,945,851 bp
  • A to T, chromosome 9 at 107,620,173 bp
  • ACCC to ACC, chromosome 9 at 114,421,744 bp
  • A to T, chromosome 10 at 70,957,190 bp
  • A to T, chromosome 10 at 91,079,989 bp
  • C to A, chromosome 11 at 75,639,530 bp
  • T to C, chromosome 11 at 100,861,426 bp
  • T to C, chromosome 11 at 103,394,944 bp
  • T to C, chromosome 11 at 105,389,882 bp
  • C to A, chromosome 11 at 121,623,488 bp
  • T to A, chromosome 12 at 8,721,710 bp
  • C to T, chromosome 12 at 102,757,788 bp
  • T to C, chromosome 13 at 67,137,355 bp
  • T to C, chromosome 13 at 97,181,110 bp
  • T to G, chromosome 14 at 12,199,783 bp
  • A to T, chromosome 14 at 20,328,664 bp
  • T to A, chromosome 14 at 30,959,306 bp
  • T to G, chromosome 14 at 50,891,683 bp
  • T to C, chromosome 14 at 103,051,516 bp
  • C to T, chromosome 14 at 121,994,342 bp
  • CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
  • G to A, chromosome 15 at 83,950,046 bp
  • G to T, chromosome 15 at 89,573,227 bp
  • A to G, chromosome 15 at 99,248,455 bp
  • A to T, chromosome 15 at 99,695,535 bp
  • A to G, chromosome 15 at 101,370,017 bp
  • A to G, chromosome 16 at 36,253,091 bp
  • C to T, chromosome 16 at 88,873,861 bp
  • G to T, chromosome 16 at 89,817,951 bp
  • A to G, chromosome 17 at 18,063,359 bp
  • A to G, chromosome 17 at 33,334,377 bp
  • A to T, chromosome 17 at 33,997,416 bp
  • C to T, chromosome 17 at 70,516,994 bp
  • A to T, chromosome 17 at 71,429,543 bp
  • A to C, chromosome 17 at 78,625,159 bp
  • A to G, chromosome 17 at 80,258,175 bp
  • A to G, chromosome 17 at 87,359,151 bp
  • G to T, chromosome 17 at 87,717,544 bp
  • A to T, chromosome 18 at 22,522,986 bp
  • A to G, chromosome 18 at 58,013,749 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0520 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038713-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.