Strain Name:
C57BL/6J-MtgxR0520Btlr/Mmmh
Stock Number:
038713-MU
Citation ID:
RRID:MMRRC_038713-MU
Other Names:
R0520 (G1), C57BL/6J-MtgxR0520Btlr
Major Collection:

Strain Information

Inpp5d
Name: inositol polyphosphate-5-phosphatase D
Synonyms: SHIP, Src homology 2 domain-containing inositol-5-phosphatase, s-SHIP, SHIP-1, SHIP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16331
HGNC: HGNC:6079
Homologene: 4046
Gnai2
Name: G protein subunit alpha i2
Synonyms: Gia, Gnai-2, Galphai2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14678
HGNC: HGNC:4385
Homologene: 55539
Dclre1c
Name: DNA cross-link repair 1C
Synonyms: 9930121L06Rik, Artemis, Art
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227525
Homologene: 32547
Plekhm1
Name: pleckstrin homology domain containing, family M (with RUN domain) member 1
Synonyms: D330036J23Rik, AP162, B2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 353047
Homologene: 8871
Inpp5k
Name: inositol polyphosphate 5-phosphatase K
Synonyms: C62, PI-5-phosphatase related, putative PI-5-phosphatase, Pps
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19062
Homologene: 75059
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Aff1
Name: AF4/FMR2 family, member 1
Synonyms: Af4, Rob, 9630032B01Rik, Mllt2h
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17355
HGNC: HGNC:7135
Homologene: 4340
Exo1
Name: exonuclease 1
Synonyms: Msa, 5730442G03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26909
HGNC: HGNC:3511
Homologene: 31352
Ptprg
Name: protein tyrosine phosphatase receptor type G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Msh2
Name: mutS homolog 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17685
HGNC: HGNC:7325
Homologene: 210
Ubac2
Name: ubiquitin associated domain containing 2
Synonyms: 1190008A14Rik, Phgdhl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68889
VEGA: 14
Homologene: 18642
Nckap1
Name: NCK-associated protein 1
Synonyms: mh19, Hem-2, H19, Nap1, Hem2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50884
HGNC: HGNC:7666
Homologene: 8384
Tpp2
Name: tripeptidyl peptidase II
Synonyms: TppII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22019
Homologene: 2471
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Smchd1
Name: SMC hinge domain containing 1
Synonyms: 4931400A14Rik, MommeD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74355
Homologene: 23665
Apaf1
Name: apoptotic peptidase activating factor 1
Synonyms: Apaf1l, 6230400I06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11783
HGNC: HGNC:576
Homologene: 7626
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21844
Homologene: 2443
Zic2
Name: zinc finger protein of the cerebellum 2
Synonyms: GENA 29, Ku, odd-paired homolog
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22772
Homologene: 5171
Bicc1
Name: BicC family RNA binding protein 1
Synonyms: Bic-C, jcpk
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83675
Homologene: 12856
Pum2
Name: pumilio RNA-binding family member 2
Synonyms: Pumm2, 5730503J23Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 80913
Homologene: 69183
Glb1
Name: galactosidase, beta 1
Synonyms: Bgs, Bge, Bgt, Bgl, Bgl-t, Bgl-s, Bgl-e, C130097A14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12091
VEGA: 9
HGNC: HGNC:4298
Homologene: 47922
Dnaja1
Name: DnaJ heat shock protein family (Hsp40) member A1
Synonyms: Hsj2, Nedd7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15502
HGNC: HGNC:5229
Homologene: 55588
Ddx20
Name: DEAD box helicase 20
Synonyms: GEMIN3, dp103, DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53975
HGNC: HGNC:2743
Homologene: 5214
Zfp81
Name: zinc finger protein 81
Synonyms: KRAB13, Zfp78, Hszfp36, C330034P10Rik, D330034E10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224694
Homologene: 138633
Cachd1
Name: cache domain containing 1
Synonyms: 1190007F10Rik, Vwcd1, B430218L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320508
Homologene: 10854
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: LOC381127, D930044O18Rik, D430002O22Rik, C230079D11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211961
Homologene: 19371
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Vit
Name: vitrin
Synonyms: 1700110E08Rik, 1700052E02Rik, 2810429K11Rik, akhirin, AKH
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74199
VEGA: 17
Homologene: 24942
Acr
Name: acrosin prepropeptide
Synonyms: preproacrosin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11434
VEGA: 15
HGNC: HGNC:126
Homologene: 855
Stat5a
Name: signal transducer and activator of transcription 5A
Synonyms: STAT5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20850
Homologene: 20680
H2-K1
Name: histocompatibility 2, K1, K region
Synonyms: H-2K
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14972
Homologene: 128352
Dhx57
Name: DExH-box helicase 57
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106794
VEGA: 17
Homologene: 56267
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Efcab6
Name: EF-hand calcium binding domain 6
Synonyms: 4932408N08Rik, 4931407K02Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77627
Homologene: 11259
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Or8b12b
Name: olfactory receptor family 8 subfamily B member 12B
Synonyms: GA_x6K02T2PVTD-31458511-31459443, MOR161-4, Olfr875
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258744
Homologene: 121527
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Cdc16
Name: CDC16 cell division cycle 16
Synonyms: 2810431D22Rik, 2700071J12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69957
HGNC: HGNC:1720
Homologene: 2899
Aldh9a1
Name: aldehyde dehydrogenase 9, subfamily A1
Synonyms: TMABA-DH, ESTM40
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56752
HGNC: HGNC:412
Homologene: 55483
Wdr64
Name: WD repeat domain 64
Synonyms: 4930415O10Rik, 4930511H01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75820
Homologene: 51634
Acod1
Name: aconitate decarboxylase 1
Synonyms: Irg1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16365
Homologene: 35405
Atg9a
Name: autophagy related 9A
Synonyms: Apg9l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 245860
Homologene: 34495
Tmc5
Name: transmembrane channel-like gene family 5
Synonyms: 4932443L08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74424
Homologene: 11713
Pam
Name: peptidylglycine alpha-amidating monooxygenase
Synonyms: PHM
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18484
HGNC: HGNC:8596
Homologene: 37369
Asic1
Name: acid-sensing ion channel 1
Synonyms: BNaC2, ASIC, ASIC1a, ASICalpha, ASIC1 beta, B530003N02Rik, ASIC1b, Accn2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11419
VEGA: 15
HGNC: HGNC:100
Homologene: 121755
Mcrs1
Name: microspherule protein 1
Synonyms: P78, ICP22BP, MSP58, C78274
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 51812
VEGA: 15
HGNC: HGNC:6960
Homologene: 4622
Igsf9b
Name: immunoglobulin superfamily, member 9B
Synonyms: LOC235086, AI414108
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235086
Homologene: 19472
Osgin1
Name: oxidative stress induced growth inhibitor 1
Synonyms: 1700012B18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71839
Homologene: 16325
Fggy
Name: FGGY carbohydrate kinase domain containing
Synonyms: 2310009E04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75578
Homologene: 49535
Ttc7
Name: tetratricopeptide repeat domain 7
Synonyms: 1110035E02Rik, 1700007L07Rik, hea, fsn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225049
Homologene: 12515
Or9s14
Name: olfactory receptor family 9 subfamily S member 14
Synonyms: GA_x6K02T2R7CC-81146179-81145211, MOR208-2, Olfr1410
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258484
Homologene: 74205
Marchf10
Name: membrane associated ring-CH-type finger 10
Synonyms: 4933417C16Rik, Rnf190, OTTMUSG00000002847, March10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 632687
Homologene: 34988
Krtap16-1
Name: keratin associated protein 16-1
Synonyms: AI450886
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 100504183
Homologene: 99988
Zfp759
Name: zinc finger protein 759
Synonyms: Rslcan-8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268670
VEGA: 13
Nek4
Name: NIMA (never in mitosis gene a)-related expressed kinase 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 23955
VEGA: 14
Homologene: 2376
Or7h8
Name: olfactory receptor family 7 subfamily H member 8
Synonyms: GA_x6K02T2PVTD-13952555-13953490, MOR141-2, Olfr871
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258905
Homologene: 138319
Klhl33
Name: kelch-like 33
Synonyms: EG546611
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 546611
VEGA: 14
Homologene: 52385
Hexb
Name: hexosaminidase B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15212
VEGA: 13
HGNC: HGNC:4879
Homologene: 437
Stap1
Name: signal transducing adaptor family member 1
Synonyms: STAP-1, Brdg1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56792
Homologene: 8103
Ecd
Name: ecdysoneless cell cycle regulator
Synonyms: 5730461K03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70601
VEGA: 14
Homologene: 5256
Vmn2r124
Name: vomeronasal 2, receptor 124
Synonyms: Gm7196, Vmn2r-ps113
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 637021
Homologene: 115024
B3gntl1
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Synonyms: 6030413G23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 210004
Homologene: 14460
Stk36
Name: serine/threonine kinase 36
Synonyms: 1700112N14Rik, Fused
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269209
Homologene: 49432
Tmem14a
Name: transmembrane protein 14A
Synonyms: PTD011, 5730496E24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75712
Homologene: 36341
Krt80
Name: keratin 80
Synonyms: 2310041I20Rik, 1200016G03Rik, Kb20
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74127
VEGA: 15
Homologene: 66610
Dlgap1
Name: DLG associated protein 1
Synonyms: SAPAP1, DAP-1 beta, D17Bwg0511e, GKAP/SAPAP, Sapap1, 4933422O14Rik, Gkap
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224997
HGNC: HGNC:2905
Homologene: 31258
Slc25a54
Name: solute carrier family 25, member 54
Synonyms: 4930443G12Rik, SCaMC-1like
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74686
Homologene: 82464
Cers6
Name: ceramide synthase 6
Synonyms: T1L, similar to TRH1, 4732462C07Rik, CerS6, Lass6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241447
Homologene: 72228
Or8k22
Name: olfactory receptor family 8 subfamily K member 22
Synonyms: GA_x6K02T2Q125-47811880-47810942, MOR188-2, Olfr1054
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259021
Homologene: 133882
Gm9871
Name: predicted gene 9871
Synonyms: EG207157
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 207157
B4galnt4
Name: beta-1,4-N-acetyl-galactosaminyl transferase 4
Synonyms: LOC381951
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330671
Homologene: 27982
Moap1
Name: modulator of apoptosis 1
Synonyms: PNMA4, MAP-1, 4930435G24Rik, 2510001G02Rik, 1700051B17Rik, 9130023M10Rik, 1700127I11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 64113
Homologene: 11154
Csta2
Name: cystatin A family member 2
Synonyms: 2010005H15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 76770
HGNC: HGNC:2481
Homologene: 3819
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 21,229,412 bp
  • A to G, chromosome 1 at 43,990,530 bp
  • T to G, chromosome 1 at 74,602,206 bp
  • C to T, chromosome 1 at 75,186,534 bp
  • T to C, chromosome 1 at 87,705,920 bp
  • T to A, chromosome 1 at 92,608,749 bp
  • T to A, chromosome 1 at 97,884,195 bp
  • T to A, chromosome 1 at 139,478,820 bp
  • T to G, chromosome 1 at 164,209,587 bp
  • C to T, chromosome 1 at 167,361,391 bp
  • A to G, chromosome 1 at 175,726,392 bp
  • T to A, chromosome 1 at 175,899,465 bp
  • A to G, chromosome 2 at 3,436,475 bp
  • C to T, chromosome 2 at 69,105,091 bp
  • A to C, chromosome 2 at 80,541,530 bp
  • G to T, chromosome 2 at 86,333,131 bp
  • T to C, chromosome 3 at 105,687,376 bp
  • T to A, chromosome 3 at 109,107,230 bp
  • A to T, chromosome 4 at 40,728,072 bp
  • T to A, chromosome 4 at 95,601,103 bp
  • T to G, chromosome 4 at 100,897,703 bp
  • C to T, chromosome 5 at 14,713,830 bp
  • A to G, chromosome 5 at 86,090,964 bp
  • C to T, chromosome 5 at 103,847,751 bp
  • G to T, chromosome 5 at 121,331,707 bp
  • A to G, chromosome 6 at 101,801,579 bp
  • T to C, chromosome 7 at 118,666,576 bp
  • T to A, chromosome 7 at 141,067,373 bp
  • G to A, chromosome 8 at 13,760,569 bp
  • A to G, chromosome 8 at 119,442,508 bp
  • G to A, chromosome 9 at 20,212,495 bp
  • C to A, chromosome 9 at 27,323,250 bp
  • T to C, chromosome 9 at 37,773,553 bp
  • T to C, chromosome 9 at 67,945,851 bp
  • A to T, chromosome 9 at 107,620,173 bp
  • ACCC to ACC, chromosome 9 at 114,421,744 bp
  • A to T, chromosome 10 at 70,957,190 bp
  • A to T, chromosome 10 at 91,079,989 bp
  • C to A, chromosome 11 at 75,639,530 bp
  • T to C, chromosome 11 at 100,861,426 bp
  • T to C, chromosome 11 at 103,394,944 bp
  • T to C, chromosome 11 at 105,389,882 bp
  • C to A, chromosome 11 at 121,623,488 bp
  • T to A, chromosome 12 at 8,721,710 bp
  • C to T, chromosome 12 at 102,757,788 bp
  • T to C, chromosome 13 at 67,137,355 bp
  • T to C, chromosome 13 at 97,181,110 bp
  • T to G, chromosome 14 at 12,199,783 bp
  • A to T, chromosome 14 at 20,328,664 bp
  • T to A, chromosome 14 at 30,959,306 bp
  • T to G, chromosome 14 at 50,891,683 bp
  • T to C, chromosome 14 at 103,051,516 bp
  • C to T, chromosome 14 at 121,994,342 bp
  • CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
  • G to A, chromosome 15 at 83,950,046 bp
  • G to T, chromosome 15 at 89,573,227 bp
  • A to G, chromosome 15 at 99,248,455 bp
  • A to T, chromosome 15 at 99,695,535 bp
  • A to G, chromosome 15 at 101,370,017 bp
  • A to G, chromosome 16 at 36,253,091 bp
  • C to T, chromosome 16 at 88,873,861 bp
  • G to T, chromosome 16 at 89,817,951 bp
  • A to G, chromosome 17 at 18,063,359 bp
  • A to G, chromosome 17 at 33,334,377 bp
  • A to T, chromosome 17 at 33,997,416 bp
  • C to T, chromosome 17 at 70,516,994 bp
  • A to T, chromosome 17 at 71,429,543 bp
  • A to C, chromosome 17 at 78,625,159 bp
  • A to G, chromosome 17 at 80,258,175 bp
  • A to G, chromosome 17 at 87,359,151 bp
  • G to T, chromosome 17 at 87,717,544 bp
  • A to T, chromosome 18 at 22,522,986 bp
  • A to G, chromosome 18 at 58,013,749 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0520 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038713-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.