Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0605Btlr/Mmmh
Stock Number:
038794-MU
Citation ID:
RRID:MMRRC_038794-MU
Other Names:
R0605 (G1), C57BL/6J-MtgxR0605Btlr
Major Collection:

Strain Information

Shprh
Name: SNF2 histone linker PHD RING helicase
Synonyms: 2610103K11Rik, D230017O13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268281
Homologene: 6489
Colgalt2
Name: collagen beta(1-O)galactosyltransferase 2
Synonyms: Glt25d2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269132
Homologene: 22865
Cd80
Name: CD80 antigen
Synonyms: B7-1, Ly-53, Ly53, Cd28l, B7.1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12519
VEGA: 16
HGNC: HGNC:1700
Homologene: 3804
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
Osbpl1a
Name: oxysterol binding protein-like 1A
Synonyms: LOC328902, G430090F17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 64291
Homologene: 84746
P4htm
Name: prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Synonyms: 4933406E20Rik, P4h-tm
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74443
Homologene: 41765
Scrib
Name: scribbled planar cell polarity
Synonyms: Scrb1, Crc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105782
Homologene: 44228
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 38,209,987 bp
  • A to G, chromosome 1 at 59,168,414 bp
  • G to T, chromosome 1 at 92,607,896 bp
  • T to C, chromosome 1 at 140,102,358 bp
  • A to T, chromosome 1 at 150,657,376 bp
  • T to A, chromosome 1 at 152,495,792 bp
  • T to C, chromosome 1 at 162,682,426 bp
  • T to C, chromosome 1 at 195,163,596 bp
  • A to G, chromosome 2 at 13,557,888 bp
  • C to T, chromosome 2 at 28,671,778 bp
  • C to T, chromosome 2 at 29,789,998 bp
  • A to T, chromosome 2 at 31,514,819 bp
  • T to A, chromosome 2 at 52,264,026 bp
  • C to T, chromosome 2 at 76,740,453 bp
  • T to C, chromosome 2 at 76,948,371 bp
  • T to C, chromosome 2 at 86,890,419 bp
  • A to T, chromosome 2 at 94,033,642 bp
  • C to A, chromosome 2 at 127,539,995 bp
  • A to G, chromosome 2 at 150,268,603 bp
  • T to C, chromosome 2 at 153,235,944 bp
  • C to T, chromosome 2 at 157,469,921 bp
  • T to C, chromosome 2 at 158,261,394 bp
  • T to A, chromosome 3 at 96,144,959 bp
  • A to G, chromosome 4 at 6,418,470 bp
  • A to G, chromosome 4 at 11,051,224 bp
  • A to T, chromosome 4 at 49,323,466 bp
  • C to T, chromosome 4 at 116,820,787 bp
  • T to A, chromosome 4 at 154,925,380 bp
  • T to C, chromosome 5 at 34,614,224 bp
  • A to G, chromosome 5 at 89,861,475 bp
  • T to C, chromosome 5 at 143,379,362 bp
  • T to A, chromosome 6 at 124,856,035 bp
  • C to A, chromosome 6 at 125,685,837 bp
  • A to G, chromosome 7 at 24,865,375 bp
  • A to T, chromosome 7 at 65,678,071 bp
  • T to C, chromosome 7 at 84,857,137 bp
  • T to C, chromosome 7 at 131,327,186 bp
  • T to C, chromosome 8 at 94,047,267 bp
  • A to G, chromosome 8 at 109,933,211 bp
  • T to C, chromosome 9 at 21,032,197 bp
  • T to C, chromosome 9 at 35,204,882 bp
  • T to C, chromosome 9 at 54,419,945 bp
  • A to T, chromosome 9 at 55,815,518 bp
  • C to T, chromosome 9 at 56,227,098 bp
  • C to T, chromosome 9 at 96,026,877 bp
  • T to C, chromosome 9 at 108,486,105 bp
  • G to A, chromosome 9 at 108,583,724 bp
  • A to G, chromosome 9 at 119,961,842 bp
  • T to C, chromosome 10 at 11,207,112 bp
  • G to A, chromosome 10 at 20,311,227 bp
  • T to C, chromosome 10 at 41,345,139 bp
  • T to C, chromosome 10 at 78,201,497 bp
  • T to C, chromosome 10 at 78,589,095 bp
  • T to A, chromosome 10 at 81,594,346 bp
  • T to C, chromosome 10 at 85,184,359 bp
  • C to T, chromosome 10 at 118,146,601 bp
  • A to G, chromosome 11 at 71,156,179 bp
  • A to G, chromosome 11 at 118,393,394 bp
  • A to G, chromosome 11 at 119,431,717 bp
  • C to T, chromosome 13 at 21,982,036 bp
  • T to A, chromosome 13 at 41,143,466 bp
  • A to G, chromosome 14 at 62,403,159 bp
  • A to G, chromosome 14 at 65,759,648 bp
  • A to T, chromosome 14 at 68,606,600 bp
  • C to T, chromosome 14 at 77,927,237 bp
  • T to G, chromosome 15 at 31,585,309 bp
  • A to G, chromosome 15 at 66,595,122 bp
  • T to C, chromosome 15 at 76,067,553 bp
  • C to A, chromosome 15 at 82,070,150 bp
  • T to C, chromosome 15 at 89,524,147 bp
  • G to T, chromosome 16 at 17,211,699 bp
  • A to T, chromosome 16 at 20,735,439 bp
  • A to T, chromosome 16 at 21,559,337 bp
  • T to C, chromosome 16 at 36,041,996 bp
  • G to A, chromosome 16 at 38,482,694 bp
  • A to C, chromosome 16 at 44,111,496 bp
  • A to T, chromosome 17 at 20,687,871 bp
  • G to A, chromosome 17 at 24,818,262 bp
  • T to C, chromosome 17 at 47,674,926 bp
  • A to G, chromosome 18 at 12,506,949 bp
  • T to A, chromosome 18 at 12,882,279 bp
  • G to A, chromosome 18 at 46,505,160 bp
  • ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC to ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC, chromosome 18 at 50,046,845 bp
  • A to G, chromosome 18 at 59,409,053 bp
  • A to G, chromosome 19 at 5,608,336 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0605 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038794-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.