Strain Name:
C57BL/6J-MtgxR0605Btlr/Mmmh
Stock Number:
038794-MU
Citation ID:
RRID:MMRRC_038794-MU
Other Names:
R0605 (G1), C57BL/6J-MtgxR0605Btlr
Major Collection:

Strain Information

Shprh
Name: SNF2 histone linker PHD RING helicase
Synonyms: D230017O13Rik, 2610103K11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 268281
Homologene: 6489
Colgalt2
Name: collagen beta(1-O)galactosyltransferase 2
Synonyms: Glt25d2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269132
Homologene: 22865
Cd80
Name: CD80 antigen
Synonyms: Ly53, B7-1, B7.1, Ly-53, Cd28l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12519
VEGA: 16
HGNC: HGNC:1700
Homologene: 3804
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 24127
Homologene: 5894
Osbpl1a
Name: oxysterol binding protein-like 1A
Synonyms: G430090F17Rik, LOC328902
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 64291
Homologene: 84746
P4htm
Name: prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Synonyms: 4933406E20Rik, P4h-tm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74443
Homologene: 41765
Scrib
Name: scribbled planar cell polarity
Synonyms: Crc, Scrb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105782
Homologene: 44228
Add1
Name: adducin 1 (alpha)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 11518
HGNC: HGNC:243
Homologene: 22758
Hsd17b12
Name: hydroxysteroid (17-beta) dehydrogenase 12
Synonyms: keratonectin, 2610510O05Rik, KIK-I, keratoadhesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 56348
Homologene: 95094
Phf20l1
Name: PHD finger protein 20-like 1
Synonyms: CGI-72, E130113K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239510
VEGA: 15
Homologene: 9341
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: Bat2l2, Bat2d, 1810043M20Rik, 9630039I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226562
Homologene: 41015
Cry1
Name: cryptochrome 1 (photolyase-like)
Synonyms: Phll1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 12952
VEGA: 10
HGNC: HGNC:2384
Homologene: 7042
Scaper
Name: S phase cyclin A-associated protein in the ER
Synonyms: D530014O03Rik, Zfp291
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244891
VEGA: 9
Homologene: 32488
Als2
Name: alsin Rho guanine nucleotide exchange factor
Synonyms: Alsin, 3222402C23Rik, 9430073A21Rik, Als2cr6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74018
HGNC: HGNC:443
Homologene: 23264
Lamb2
Name: laminin, beta 2
Synonyms: npht, Lamb-2, Lams
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 16779
HGNC: HGNC:6487
Homologene: 1723
Atp6v1a
Name: ATPase, H+ transporting, lysosomal V1 subunit A
Synonyms: lysosomal 70kDa, VA68, Atp6a1, VPP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 11964
HGNC: HGNC:851
Homologene: 123934
Otud7b
Name: OTU domain containing 7B
Synonyms: 2900060B22Rik, 4930463P07Rik, Za20d1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229603
Homologene: 10624
Zfp1005
Name: zinc finger protein 1005
Synonyms: Gm10749, Gm14124, EG640962
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100216455
Homologene: 134546
Nsmaf
Name: neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms: Fan, factor associated with N-SMase activation
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18201
HGNC: HGNC:8017
Homologene: 2652
Trappc10
Name: trafficking protein particle complex 10
Synonyms: b2b2416Clo, B230307C21Rik, Tmem1, LOC380642, b2b2613Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216131
VEGA: 10
Homologene: 37751
Vps8
Name: VPS8 CORVET complex subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 209018
Homologene: 44592
Dmxl2
Name: Dmx-like 2
Synonyms: E130119P06Rik, 6430411K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Grid2ip
Name: glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1
Synonyms: delphilin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 170935
Homologene: 15781
Icam5
Name: intercellular adhesion molecule 5, telencephalin
Synonyms: CD50, Tlcn, TLN, Icam3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 15898
VEGA: 9
HGNC: HGNC:5348
Homologene: 2447
Ass1
Name: argininosuccinate synthetase 1
Synonyms: ASS, Ass-1, fold
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11898
HGNC: HGNC:758
Homologene: 6899
Plppr1
Name: phospholipid phosphatase related 1
Synonyms: Lppr1, PRG-3, E130309F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 272031
Homologene: 9815
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 74369
Homologene: 46535
Lypd4
Name: Ly6/Plaur domain containing 4
Synonyms: 4933400F01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232973
Homologene: 45458
Src
Name: Rous sarcoma oncogene
Synonyms: pp60c-src
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20779
Homologene: 21120
Tsc1
Name: TSC complex subunit 1
Synonyms: hamartin, tuberous sclerosis 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 64930
Homologene: 314
Peak1
Name: pseudopodium-enriched atypical kinase 1
Synonyms: NKF3 kinase family member, 1110049L02Rik, C230081A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244895
Homologene: 18259
Tars3
Name: threonyl-tRNA synthetase 3
Synonyms: A530046H20Rik, Tarsl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 272396
Homologene: 65036
Fem1c
Name: fem 1 homolog c
Synonyms: 2610312A07Rik, 3632443A22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 240263
Homologene: 10606
Prom2
Name: prominin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 192212
Homologene: 44536
Sycp2l
Name: synaptonemal complex protein 2-like
Synonyms: EG621792, LOC218175, Gm40956
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 637277
Homologene: 52882
Ttn
Name: titin
Synonyms: L56, 1100001C23Rik, D330041I19Rik, 2310057K23Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, connectin, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Hmcn1
Name: hemicentin 1
Synonyms: EG545370, LOC240793
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545370
Homologene: 23741
P3h3
Name: prolyl 3-hydroxylase 3
Synonyms: Grcb, Leprel2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14789
Homologene: 8401
Chsy3
Name: chondroitin sulfate synthase 3
Synonyms: 4833446K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 78923
VEGA: 18
Homologene: 28624
Nlrp1b
Name: NLR family, pyrin domain containing 1B
Synonyms: Nalp1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 637515
Homologene: 19080
Aff3
Name: AF4/FMR2 family, member 3
Synonyms: LAF-4, 3222402O04Rik, Laf4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16764
HGNC: HGNC:6473
Homologene: 1718
Lama3
Name: laminin, alpha 3
Synonyms: [a]3B, nicein, 150kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 672511
Homologene: 45439
Neb
Name: nebulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Syde1
Name: synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Synonyms: 1200008N06Rik, mSYD1A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 71709
VEGA: 10
Homologene: 13195
Chrd
Name: chordin
Synonyms: Chd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12667
HGNC: HGNC:1949
Homologene: 2774
Vwf
Name: Von Willebrand factor
Synonyms: B130011O06Rik, 6820430P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22371
Homologene: 466
Scara5
Name: scavenger receptor class A, member 5
Synonyms: 4932433F15Rik, 4933425F03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 71145
Homologene: 12556
Adamts3
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3
Synonyms: 1100001H14Rik, 6330442E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 330119
HGNC: HGNC:219
Homologene: 8596
Or8h7
Name: olfactory receptor family 8 subfamily H member 7
Synonyms: GA_x6K02T2Q125-48376288-48375341, Olfr1097, MOR206-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258840
Homologene: 37005
Ttc21a
Name: tetratricopeptide repeat domain 21A
Synonyms: 4921538N17Rik, Thm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74052
Homologene: 14728
Ak9
Name: adenylate kinase 9
Synonyms: Akd2, Akd1, Gm7127, LOC215946
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 633979
Homologene: 67934
Mdm1
Name: transformed mouse 3T3 cell double minute 1
Synonyms: Mdm-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17245
VEGA: 10
Homologene: 9692
Bpi
Name: bactericidal permeablility increasing protein
Synonyms: 9230105K17Rik, Bpifd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329547
HGNC: HGNC:1095
Homologene: 37519
Phlpp2
Name: PH domain and leucine rich repeat protein phosphatase 2
Synonyms: Phlppl, C130044A18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244650
Homologene: 71015
Or5ae2
Name: olfactory receptor family 5 subfamily AE member 2
Synonyms: GA_x6K02T2NHDJ-11231385-11230438, Olfr291, MOR254-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258410
Homologene: 83130
Plagl2
Name: pleiomorphic adenoma gene-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 54711
HGNC: HGNC:9047
Homologene: 1994
Meiob
Name: meiosis specific with OB domains
Synonyms: 4930528F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 75178
VEGA: 17
Homologene: 102013
Gucy1b2
Name: guanylate cyclase 1, soluble, beta 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239134
HGNC: HGNC:4686
Homologene: 136630
Adam28
Name: a disintegrin and metallopeptidase domain 28
Synonyms: D430033C21Rik, C130072N01Rik, MDC-L, Dtgn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 13522
VEGA: 14
HGNC: HGNC:206
Homologene: 40705
Or9s14
Name: olfactory receptor family 9 subfamily S member 14
Synonyms: Olfr1410, MOR208-2, GA_x6K02T2R7CC-81146179-81145211
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 258484
Homologene: 74205
Foxred1
Name: FAD-dependent oxidoreductase domain containing 1
Synonyms: TEG-23, Tex23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235169
Homologene: 9712
Vmn1r226
Name: vomeronasal 1 receptor 226
Synonyms: V1re2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 171225
Homologene: 74362
Cfh
Name: complement component factor h
Synonyms: Mud-1, Sas-1, Sas1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12628
Homologene: 20086
Tnfrsf14
Name: tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)
Synonyms: HveA, Atar, Hvem
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230979
Homologene: 2833
Rimbp3
Name: RIMS binding protein 3
Synonyms: RIM-BP3, LOC239731, LOC385766
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239731
Homologene: 77940
Shank3
Name: SH3 and multiple ankyrin repeat domains 3
Synonyms: ProSAP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 58234
Homologene: 75163
Epsti1
Name: epithelial stromal interaction 1 (breast)
Synonyms: BRESI1, 5033415K03Rik, 2310046K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 108670
VEGA: 14
Homologene: 12630
Lgals3bp
Name: lectin, galactoside-binding, soluble, 3 binding protein
Synonyms: Ppicap, Tango10b, MAC-2BP, 90K, CyCAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19039
HGNC: HGNC:6564
Homologene: 4067
Cmbl
Name: carboxymethylenebutenolidase-like (Pseudomonas)
Synonyms: 2310016A09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 69574
Homologene: 100714
Cr2
Name: complement receptor 2
Synonyms: C3DR, Cr-1, CD35, Cr1, CD21, Cr-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12902
HGNC: HGNC:2336
Homologene: 55611
Ogfod1
Name: 2-oxoglutarate and iron-dependent oxygenase domain containing 1
Synonyms: 4930415J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 270086
Homologene: 41238
Pom121l2
Name: POM121 transmembrane nucleoporin like 2
Synonyms: LOC195236
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 195236
Homologene: 123536
Hpdl
Name: 4-hydroxyphenylpyruvate dioxygenase-like
Synonyms: A830048M07Rik, Gloxd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242642
Homologene: 13109
Tle6
Name: transducin-like enhancer of split 6
Synonyms: 1810057E06Rik, Grg6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 114606
Homologene: 11701
Gm9875
Name: predicted gene 9875
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 105244085
VEGA: 2
Coq4
Name: coenzyme Q4
Synonyms: EST-MNCb4625, D2Ertd97e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227683
Homologene: 68641
Ndufaf6
Name: NADH:ubiquinone oxidoreductase complex assembly factor 6
Synonyms: 2310030N02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 76947
Homologene: 43831
Fam24b
Name: family with sequence similarity 24 member B
Synonyms: 1700007K09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 69318
Homologene: 78032
4933406P04Rik
Name: RIKEN cDNA 4933406P04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Wdr5b
Name: WD repeat domain 5B
Synonyms: 2310009C03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 69544
VEGA: 16
Homologene: 41307
Usp49
Name: ubiquitin specific peptidase 49
Synonyms: C330046L10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224836
Homologene: 10235
AC120859.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Kat5
Name: K(lysine) acetyltransferase 5
Synonyms: Htatip, Tip60, PLIP, mHTATIP/CPLA2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 81601
VEGA: 19
HGNC: HGNC:5275
Homologene: 100661
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 38,209,987 bp
  • A to G, chromosome 1 at 59,168,414 bp
  • G to T, chromosome 1 at 92,607,896 bp
  • T to C, chromosome 1 at 140,102,358 bp
  • A to T, chromosome 1 at 150,657,376 bp
  • T to A, chromosome 1 at 152,495,792 bp
  • T to C, chromosome 1 at 162,682,426 bp
  • T to C, chromosome 1 at 195,163,596 bp
  • A to G, chromosome 2 at 13,557,888 bp
  • C to T, chromosome 2 at 28,671,778 bp
  • C to T, chromosome 2 at 29,789,998 bp
  • A to T, chromosome 2 at 31,514,819 bp
  • T to A, chromosome 2 at 52,264,026 bp
  • C to T, chromosome 2 at 76,740,453 bp
  • T to C, chromosome 2 at 76,948,371 bp
  • T to C, chromosome 2 at 86,890,419 bp
  • A to T, chromosome 2 at 94,033,642 bp
  • C to A, chromosome 2 at 127,539,995 bp
  • A to G, chromosome 2 at 150,268,603 bp
  • T to C, chromosome 2 at 153,235,944 bp
  • C to T, chromosome 2 at 157,469,921 bp
  • T to C, chromosome 2 at 158,261,394 bp
  • T to A, chromosome 3 at 96,144,959 bp
  • A to G, chromosome 4 at 6,418,470 bp
  • A to G, chromosome 4 at 11,051,224 bp
  • A to T, chromosome 4 at 49,323,466 bp
  • C to T, chromosome 4 at 116,820,787 bp
  • T to A, chromosome 4 at 154,925,380 bp
  • T to C, chromosome 5 at 34,614,224 bp
  • A to G, chromosome 5 at 89,861,475 bp
  • T to C, chromosome 5 at 143,379,362 bp
  • T to A, chromosome 6 at 124,856,035 bp
  • C to A, chromosome 6 at 125,685,837 bp
  • A to G, chromosome 7 at 24,865,375 bp
  • A to T, chromosome 7 at 65,678,071 bp
  • T to C, chromosome 7 at 84,857,137 bp
  • T to C, chromosome 7 at 131,327,186 bp
  • T to C, chromosome 8 at 94,047,267 bp
  • A to G, chromosome 8 at 109,933,211 bp
  • T to C, chromosome 9 at 21,032,197 bp
  • T to C, chromosome 9 at 35,204,882 bp
  • T to C, chromosome 9 at 54,419,945 bp
  • A to T, chromosome 9 at 55,815,518 bp
  • C to T, chromosome 9 at 56,227,098 bp
  • C to T, chromosome 9 at 96,026,877 bp
  • T to C, chromosome 9 at 108,486,105 bp
  • G to A, chromosome 9 at 108,583,724 bp
  • A to G, chromosome 9 at 119,961,842 bp
  • T to C, chromosome 10 at 11,207,112 bp
  • G to A, chromosome 10 at 20,311,227 bp
  • T to C, chromosome 10 at 41,345,139 bp
  • T to C, chromosome 10 at 78,201,497 bp
  • T to C, chromosome 10 at 78,589,095 bp
  • T to A, chromosome 10 at 81,594,346 bp
  • T to C, chromosome 10 at 85,184,359 bp
  • C to T, chromosome 10 at 118,146,601 bp
  • A to G, chromosome 11 at 71,156,179 bp
  • A to G, chromosome 11 at 118,393,394 bp
  • A to G, chromosome 11 at 119,431,717 bp
  • C to T, chromosome 13 at 21,982,036 bp
  • T to A, chromosome 13 at 41,143,466 bp
  • A to G, chromosome 14 at 62,403,159 bp
  • A to G, chromosome 14 at 65,759,648 bp
  • A to T, chromosome 14 at 68,606,600 bp
  • C to T, chromosome 14 at 77,927,237 bp
  • T to G, chromosome 15 at 31,585,309 bp
  • A to G, chromosome 15 at 66,595,122 bp
  • T to C, chromosome 15 at 76,067,553 bp
  • C to A, chromosome 15 at 82,070,150 bp
  • T to C, chromosome 15 at 89,524,147 bp
  • G to T, chromosome 16 at 17,211,699 bp
  • A to T, chromosome 16 at 20,735,439 bp
  • A to T, chromosome 16 at 21,559,337 bp
  • T to C, chromosome 16 at 36,041,996 bp
  • G to A, chromosome 16 at 38,482,694 bp
  • A to C, chromosome 16 at 44,111,496 bp
  • A to T, chromosome 17 at 20,687,871 bp
  • G to A, chromosome 17 at 24,818,262 bp
  • T to C, chromosome 17 at 47,674,926 bp
  • A to G, chromosome 18 at 12,506,949 bp
  • T to A, chromosome 18 at 12,882,279 bp
  • G to A, chromosome 18 at 46,505,160 bp
  • ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC to ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC, chromosome 18 at 50,046,845 bp
  • A to G, chromosome 18 at 59,409,053 bp
  • A to G, chromosome 19 at 5,608,336 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0605 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038794-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.