Strain Name:
Stock Number:
Citation ID:
Other Names:
R0686 (G1), C57BL/6J-MtgxR0686Btlr
Major Collection:

Strain Information

Name: cyclin E2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12448
Homologene: 7660
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19014
Homologene: 21002
Name: PHD finger protein 14
Synonyms: 1110001C23Rik, 4932409F11Rik, 5730446A07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 75725
Homologene: 8775
Name: Rho guanine nucleotide exchange factor (GEF) 12
Synonyms: LARG, 2310014B11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 69632
Homologene: 9088
Name: iron responsive element binding protein 2
Synonyms: Irp2, D9Ertd85e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 64602
Homologene: 11280
Name: DNA primase, p58 subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19076
Homologene: 731
Name: fused in sarcoma
Synonyms: translocated in liposarcoma, Tls, hnRNP P2, pigpen, D930039C12Rik, D430004D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233908
Homologene: 134091
Name: potassium channel tetramerisation domain containing 9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105440
Homologene: 9754
Name: brain specific homeobox
Synonyms: Bsx1b, Bsx1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244813
Homologene: 65347
Name: FHF complex subunit HOOK interacting protein 1B
Synonyms: 4632419K20Rik, 6530415H11Rik, Fam160a2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74349
Homologene: 75329
Name: creatine kinase, brain
Synonyms: Ck-3, B-CK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 12709
VEGA: 12
Homologene: 37530
Name: mutS homolog 3
Synonyms: D13Em1, Rep-3, Rep3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17686
Homologene: 1829
Name: secreted frizzled-related protein 2
Synonyms: Sdf5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20319
Homologene: 56438
Name: cytochrome P450, family 2, subfamily r, polypeptide 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244209
Homologene: 75210
Name: lymphotoxin B receptor
Synonyms: TNFRrp, TNF receptor-related protein, LT-beta receptor, LT beta-R, Tnfbr, Ltar, TNF-R-III, TNFCR, TNFR2-RP, LTbetaR, Tnfrsf3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17000
Homologene: 1753
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244653
Homologene: 52118
Name: RIKEN cDNA 1700123K08 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 76658
Homologene: 86127
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56087
Homologene: 25816
Name: RAS and EF hand domain containing
Synonyms: RAB45
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242505
Homologene: 28424
Name: AVL9 cell migration associated
Synonyms: D730049P16Rik, 5830411G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 78937
Homologene: 62425
Name: EPS8-like 1
Synonyms: 4632407K17Rik, EPS8R1, DRC3, 2310051G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67425
Homologene: 15767
Name: protease, serine 59
Synonyms: Tryx5, 1700074P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 73481
Homologene: 49905
Name: tudor domain containing 1
Synonyms: MTR-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 83561
Homologene: 12850
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230806
Homologene: 19232
Name: vomeronasal 1 receptor 214
Synonyms: V1rh5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 171248
Homologene: 110880
Name: SUMO-interacting motifs containing 1
Synonyms: 4732471D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 319719
Homologene: 131217
Name: formyl peptide receptor, related sequence 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14291
Homologene: 130629
Name: family with sequence similarity 102, member B
Synonyms: 1600010D10Rik, B430201A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329739
Homologene: 46568
Name: olfactory receptor family 2 subfamily AG member 13
Synonyms: GA_x6K02T2PBJ9-9092181-9091234, MOR283-6, Olfr695
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258591
Homologene: 133597
Name: progestin and adipoQ receptor family member V
Synonyms: 0610010I15Rik, mPRg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74090
Homologene: 9788
Name: carboxylesterase 1A
Synonyms: Gm4976
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244595
Homologene: 134142
Name: PIH1 domain containing 1
Synonyms: 4933413A04Rik, 1110061L23Rik, Nop17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68845
Homologene: 9914
Name: olfactory receptor family 8 subfamily G member 37
Synonyms: GA_x6K02T2PVTD-33517322-33518257, MOR171-16, Olfr970
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258604
Homologene: 121532
Name: predicted gene 340
Synonyms: LOC381224
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 33,514,189 bp
  • T to C, chromosome 3 at 83,769,412 bp
  • G to A, chromosome 3 at 108,992,685 bp
  • T to A, chromosome 4 at 11,197,220 bp
  • A to G, chromosome 4 at 73,734,534 bp
  • TGGAGGAGGAGGAGGAGGAG to TGGAGGAGGAGGAGGAG, chromosome 4 at 134,074,526 bp
  • T to C, chromosome 5 at 124,747,718 bp
  • C to T, chromosome 5 at 138,564,537 bp
  • T to A, chromosome 6 at 11,997,011 bp
  • G to A, chromosome 6 at 40,928,518 bp
  • C to T, chromosome 6 at 56,728,594 bp
  • T to C, chromosome 6 at 125,308,061 bp
  • T to A, chromosome 7 at 4,477,450 bp
  • T to A, chromosome 7 at 45,156,329 bp
  • G to T, chromosome 7 at 105,388,309 bp
  • A to T, chromosome 7 at 106,714,378 bp
  • T to G, chromosome 7 at 114,552,011 bp
  • G to A, chromosome 7 at 127,972,763 bp
  • A to G, chromosome 8 at 93,022,449 bp
  • A to G, chromosome 8 at 110,564,015 bp
  • A to C, chromosome 9 at 39,819,668 bp
  • T to G, chromosome 9 at 40,876,437 bp
  • A to C, chromosome 9 at 42,993,028 bp
  • A to T, chromosome 9 at 54,904,176 bp
  • T to G, chromosome 9 at 61,972,794 bp
  • G to A, chromosome 11 at 98,158,404 bp
  • A to G, chromosome 12 at 111,670,193 bp
  • T to A, chromosome 13 at 23,034,792 bp
  • T to A, chromosome 13 at 54,525,190 bp
  • G to A, chromosome 13 at 92,351,431 bp
  • A to G, chromosome 14 at 67,728,736 bp
  • A to C, chromosome 17 at 18,022,351 bp
  • T to A, chromosome 19 at 41,582,372 bp
  • A to T, chromosome 19 at 56,856,051 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0686 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038871-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.