Strain Name:
C57BL/6J-MtgxR0690Btlr/Mmmh
Stock Number:
038875-MU
Citation ID:
RRID:MMRRC_038875-MU
Other Names:
R0690 (G1), C57BL/6J-MtgxR0690Btlr
Major Collection:

Strain Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Del1, Rgsc856, Col2, Col2a, Col2a-1, M100413, Rgsc413, M100856, Lpk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
St8sia1
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Synonyms: ST8Sia I, Siat8a, GD3 synthase, alpha-2,8-sialyltransferase, 9330109E03Rik, GD3S, Siat8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20449
Homologene: 2282
Fam117b
Name: family with sequence similarity 117, member B
Synonyms: 2810425F24Rik, 6330416D14Rik, Als2cr13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 72750
Homologene: 18307
Avpr1b
Name: arginine vasopressin receptor 1B
Synonyms: V1BR, V3/V1b pituitary vasopressin receptor, V3/V1b, V1bR, AVPR3, VPR3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 26361
HGNC: HGNC:896
Homologene: 22678
Nucb2
Name: nucleobindin 2
Synonyms: Calnuc, nesfatin-1, NEFA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 53322
HGNC: HGNC:8044
Homologene: 3676
Trdmt1
Name: tRNA aspartic acid methyltransferase 1
Synonyms: Dnmt2, Rnmt2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13434
HGNC: HGNC:2977
Homologene: 3249
Slco1a5
Name: solute carrier organic anion transporter family, member 1a5
Synonyms: Oatp3, Slc21a7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108096
Homologene: 56603
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Pmpca
Name: peptidase (mitochondrial processing) alpha
Synonyms: Alpha-MPP, INPP5E, 4933435E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66865
Homologene: 6078
Thbs3
Name: thrombospondin 3
Synonyms: Thbs-3, TSP3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 21827
Homologene: 5159
Rad54l
Name: RAD54 like (S. cerevisiae)
Synonyms: RAD54
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19366
HGNC: HGNC:9826
Homologene: 48227
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Glur-4, spkw1, Glur4, Gluralpha4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: Vprbp, B930007L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 321006
Homologene: 8805
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Bcl7a
Name: B cell CLL/lymphoma 7A
Synonyms: 4432415N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 77045
HGNC: HGNC:1004
Homologene: 10869
Gab1
Name: growth factor receptor bound protein 2-associated protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 14388
HGNC: HGNC:4066
Homologene: 1542
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: 2810449H11Rik, tbl, D130015N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Ascc2
Name: activating signal cointegrator 1 complex subunit 2
Synonyms: 1700011I11Rik, 2610034L15Rik, ASC1p100
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 75452
Homologene: 41774
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, enaptin165, A330049M09Rik, C130039F11Rik, SYNE-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Ahi1
Name: Abelson helper integration site 1
Synonyms: Jouberin, 1700015F03Rik, Ahi-1, D10Bwg0629e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 52906
VEGA: 10
Homologene: 9762
Klf13
Name: Kruppel-like factor 13
Synonyms: Bteb3, 9430029L20Rik, FKLF-2, NSLP1, RFLAT1, Klf13, RFLAT-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 50794
Homologene: 32288
Dcc
Name: deleted in colorectal carcinoma
Synonyms: Igdcc1, C030036D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13176
HGNC: HGNC:2701
Homologene: 21081
Gda
Name: guanine deaminase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 14544
HGNC: HGNC:4212
Homologene: 3171
Cldn8
Name: claudin 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 54420
HGNC: HGNC:2050
Homologene: 8117
Nsun2
Name: NOL1/NOP2/Sun domain family member 2
Synonyms: Misu
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 28114
Homologene: 9817
Ubr2
Name: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224826
VEGA: 17
Homologene: 26151
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Stxbp1
Name: syntaxin binding protein 1
Synonyms: Unc18h, nsec1, N-sec1, Rb-sec1, Sxtbp1, Munc18-1, Munc-18a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20910
Homologene: 2382
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: Dnahc6, A730004I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Slc1a5
Name: solute carrier family 1 (neutral amino acid transporter), member 5
Synonyms: ASCT2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20514
Homologene: 21155
Trpv2
Name: transient receptor potential cation channel, subfamily V, member 2
Synonyms: Vrl1, VRL-1, OTRPC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 22368
Homologene: 7993
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: EGFL2, flamingo, mfmi1, Adgrc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Pik3r4
Name: phosphoinositide-3-kinase regulatory subunit 4
Synonyms: p150, Vps15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75669
HGNC: HGNC:8982
Homologene: 24678
Rab33b
Name: RAB33B, member RAS oncogene family
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 19338
Homologene: 9642
Tmem209
Name: transmembrane protein 209
Synonyms: 2700094F01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 72649
Homologene: 18021
Ptpdc1
Name: protein tyrosine phosphatase domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218232
VEGA: 13
Homologene: 17576
Sptbn5
Name: spectrin beta, non-erythrocytic 5
Synonyms: Spnb5, EG640524
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 640524
Homologene: 41150
Ifi30
Name: interferon gamma inducible protein 30
Synonyms: GILT, lysosomal thio reductase IP30 precursor, IP30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 65972
VEGA: 8
HGNC: HGNC:5398
Homologene: 38171
Col6a6
Name: collagen, type VI, alpha 6
Synonyms: E330026B02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 245026
Homologene: 18260
Abi3
Name: ABI family member 3
Synonyms: 2210414K06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66610
Homologene: 9505
Nox3
Name: NADPH oxidase 3
Synonyms: nmf250, het
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224480
HGNC: HGNC:7890
Homologene: 49435
Slc47a2
Name: solute carrier family 47, member 2
Synonyms: 4933429E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380701
Homologene: 134426
Cfap69
Name: cilia and flagella associated protein 69
Synonyms: A330021E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 207686
Homologene: 11718
Guf1
Name: GUF1 homolog, GTPase
Synonyms: mtEF4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231279
Homologene: 6505
Ctse
Name: cathepsin E
Synonyms: C920004C08Rik, CE, CatE, A430072O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13034
HGNC: HGNC:2530
Homologene: 37551
Abca8b
Name: ATP-binding cassette, sub-family A (ABC1), member 8b
Synonyms: Abca8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 27404
HGNC: HGNC:38
Homologene: 56029
Or5be3
Name: olfactory receptor family 5 subfamily BE member 3
Synonyms: GA_x6K02T2Q125-48521031-48520093, MOR172-7, MOR0-6P, Olfr1105
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258085
Homologene: 121541
Npr2
Name: natriuretic peptide receptor 2
Synonyms: guanylyl cyclase-B, cn, pwe
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230103
HGNC: HGNC:7944
Homologene: 2970
Coq8b
Name: coenzyme Q8B
Synonyms: Adck4, 0610012P18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 76889
Homologene: 86731
Frem3
Name: Fras1 related extracellular matrix protein 3
Synonyms: LOC333315
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 333315
Homologene: 35388
Chaf1b
Name: chromatin assembly factor 1, subunit B (p60)
Synonyms: MPHOSPH7, CAF-1 subunit B, CAF-I 60 kDa subunit, CAF1P60, 2600017H24Rik, CAF1A, CAF-IP60, CAF1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 110749
HGNC: HGNC:1911
Homologene: 48346
Col6a4
Name: collagen, type VI, alpha 4
Synonyms: Vwa6, Dvwa, EG235580, 1110001D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68553
Homologene: 130754
Adam2
Name: a disintegrin and metallopeptidase domain 2
Synonyms: Ph30-beta, Ftnb, fertilin beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 11495
VEGA: 14
HGNC: HGNC:198
Homologene: 1127
Nat2
Name: N-acetyltransferase 2 (arylamine N-acetyltransferase)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 17961
Homologene: 37329
Cfap57
Name: cilia and flagella associated protein 57
Synonyms: C130004B06Rik, 1110020C03Rik, Wdr65, LOC384050
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68625
Homologene: 51350
Gpnmb
Name: glycoprotein (transmembrane) nmb
Synonyms: Dchil, Osteoactivin, DC-HIL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 93695
HGNC: HGNC:4462
Homologene: 1880
Agbl4
Name: ATP/GTP binding protein-like 4
Synonyms: 4930578N11Rik, 4931433A01Rik, Ccp6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 78933
Homologene: 84880
Myom3
Name: myomesin family, member 3
Synonyms: 8430427K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242702
Homologene: 19432
Sp6
Name: trans-acting transcription factor 6
Synonyms: Epfn, epiprofin, Klf14, 1110025J03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83395
Homologene: 19879
Sry
Name: sex determining region of Chr Y
Synonyms: Tdf, Tdy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 21674
Tmem8b
Name: transmembrane protein 8B
Synonyms: 4930500O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242409
Homologene: 72894
Pyroxd2
Name: pyridine nucleotide-disulphide oxidoreductase domain 2
Synonyms: 4833409A17Rik, 3830409H07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 74580
VEGA: 19
Homologene: 13097
Qrfpr
Name: pyroglutamylated RFamide peptide receptor
Synonyms: AQ27, Gpr103
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229214
Homologene: 18865
H6pd
Name: hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
Synonyms: Gpd1, G6pd1, Gpd-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100198
HGNC: HGNC:4795
Homologene: 48275
Cyp2c29
Name: cytochrome P450, family 2, subfamily c, polypeptide 29
Synonyms: P450-2C, AHOHase, AHOH, Cyp2c, Ah-2, Ahh-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13095
Homologene: 117948
Use1
Name: unconventional SNARE in the ER 1 homolog (S. cerevisiae)
Synonyms: 5730403H22Rik, mED2, Q-SNARE, D12, 2010315L10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67023
Homologene: 10214
Tmem25
Name: transmembrane protein 25
Synonyms: 0610039J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71687
Homologene: 12403
Fam216a
Name: family with sequence similarity 216, member A
Synonyms: 1500011H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 68948
Homologene: 8328
Or8b12
Name: olfactory receptor family 8 subfamily B member 12
Synonyms: MOR161-2, GA_x6K02T2PVTD-31428850-31429782, Olfr874
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258882
Homologene: 17377
Tll1
Name: tolloid-like
Synonyms: Tll-1, b2b2476Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 21892
Homologene: 49202
Slfn5
Name: schlafen 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327978
Homologene: 18839
Arsj
Name: arylsulfatase J
Synonyms: 9330196J05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 271970
Homologene: 35257
Med11
Name: mediator complex subunit 11
Synonyms: 1110030J09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66172
Homologene: 32630
Cd160
Name: CD160 antigen
Synonyms: By55
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 54215
Homologene: 5122
Trim63
Name: tripartite motif-containing 63
Synonyms: Rnf28, MuRF1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433766
Homologene: 41878
Nkx3-2
Name: NK3 homeobox 2
Synonyms: Nkx-3.2, Bapx1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12020
HGNC: HGNC:951
Homologene: 68168
Orai2
Name: ORAI calcium release-activated calcium modulator 2
Synonyms: Tmem142b, A730041O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 269717
Homologene: 32799
Pcyox1
Name: prenylcysteine oxidase 1
Synonyms: PCL1, 1200015P13Rik, Pcly
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66881
Homologene: 9458
Zfp850
Name: zinc finger protein 850
Synonyms: Gm4636, C130069I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100043772
Or13a26
Name: olfactory receptor family 13 subfamily A member 26
Synonyms: GA_x6K02T2PBJ9-42850324-42851256, MOR253-3, Olfr541
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258964
Homologene: 138322
Aifm2
Name: apoptosis-inducing factor, mitochondrion-associated 2
Synonyms: PRG3, D730001I10Rik, 5430437E11Rik, Amid
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 71361
Homologene: 6862
Gpr156
Name: G protein-coupled receptor 156
Synonyms: Gababl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239845
VEGA: 16
Homologene: 17683
Nhlrc4
Name: NHL repeat containing 4
Synonyms: F430201B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 621239
Homologene: 134625
Gm5093
Name: predicted gene 5093
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 328825
VEGA: 17
Rad9a
Name: RAD9 checkpoint clamp component A
Synonyms: Rad9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 19367
VEGA: 19
HGNC: HGNC:9827
Homologene: 32118
Dkk1
Name: dickkopf WNT signaling pathway inhibitor 1
Synonyms: mdkk-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13380
HGNC: HGNC:2891
Homologene: 7689
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 59,958,353 bp
  • C to A, chromosome 1 at 118,844,460 bp
  • T to C, chromosome 1 at 131,600,281 bp
  • T to C, chromosome 1 at 131,674,778 bp
  • G to T, chromosome 1 at 134,876,082 bp
  • T to A, chromosome 2 at 13,544,580 bp
  • T to A, chromosome 2 at 26,391,097 bp
  • C to A, chromosome 2 at 32,800,695 bp
  • A to G, chromosome 2 at 87,033,882 bp
  • A to G, chromosome 2 at 120,062,675 bp
  • G to A, chromosome 3 at 36,189,559 bp
  • A to G, chromosome 3 at 51,493,417 bp
  • T to A, chromosome 3 at 89,220,165 bp
  • T to A, chromosome 3 at 96,805,786 bp
  • C to A, chromosome 3 at 108,414,977 bp
  • C to T, chromosome 3 at 126,438,184 bp
  • A to T, chromosome 4 at 43,646,991 bp
  • T to C, chromosome 4 at 43,674,562 bp
  • T to A, chromosome 4 at 111,657,388 bp
  • G to T, chromosome 4 at 116,099,750 bp
  • A to G, chromosome 4 at 118,569,727 bp
  • A to G, chromosome 4 at 134,316,405 bp
  • A to G, chromosome 4 at 135,788,426 bp
  • T to C, chromosome 4 at 149,982,573 bp
  • T to G, chromosome 4 at 156,174,453 bp
  • G to A, chromosome 5 at 5,663,951 bp
  • G to A, chromosome 5 at 41,762,127 bp
  • C to A, chromosome 5 at 69,566,352 bp
  • A to T, chromosome 5 at 122,367,646 bp
  • G to A, chromosome 5 at 123,351,940 bp
  • A to T, chromosome 5 at 136,161,599 bp
  • A to C, chromosome 6 at 30,505,834 bp
  • C to T, chromosome 6 at 49,048,015 bp
  • A to G, chromosome 6 at 73,129,474 bp
  • A to T, chromosome 6 at 86,394,442 bp
  • T to A, chromosome 6 at 142,268,278 bp
  • A to G, chromosome 6 at 142,829,254 bp
  • A to T, chromosome 7 at 16,786,904 bp
  • A to G, chromosome 7 at 27,242,249 bp
  • A to T, chromosome 7 at 27,985,217 bp
  • G to A, chromosome 7 at 63,938,071 bp
  • T to C, chromosome 7 at 116,535,851 bp
  • T to C, chromosome 7 at 140,704,787 bp
  • C to T, chromosome 8 at 64,074,290 bp
  • A to T, chromosome 8 at 67,501,804 bp
  • T to A, chromosome 8 at 70,764,949 bp
  • A to T, chromosome 8 at 71,367,065 bp
  • T to A, chromosome 8 at 80,613,952 bp
  • T to A, chromosome 8 at 80,800,116 bp
  • A to G, chromosome 9 at 4,427,071 bp
  • T to C, chromosome 9 at 37,746,217 bp
  • C to T, chromosome 9 at 44,795,514 bp
  • T to A, chromosome 9 at 66,386,838 bp
  • C to A, chromosome 9 at 105,653,976 bp
  • T to C, chromosome 9 at 105,709,486 bp
  • T to C, chromosome 9 at 106,028,187 bp
  • T to A, chromosome 9 at 106,846,649 bp
  • A to G, chromosome 10 at 5,033,138 bp
  • A to G, chromosome 10 at 20,970,843 bp
  • A to G, chromosome 10 at 61,726,452 bp
  • T to A, chromosome 11 at 4,682,933 bp
  • C to T, chromosome 11 at 61,342,504 bp
  • T to C, chromosome 11 at 62,584,676 bp
  • T to A, chromosome 11 at 70,453,226 bp
  • T to C, chromosome 11 at 82,961,403 bp
  • T to C, chromosome 11 at 95,833,634 bp
  • C to T, chromosome 11 at 97,021,544 bp
  • T to A, chromosome 11 at 109,969,808 bp
  • A to G, chromosome 13 at 48,586,905 bp
  • A to G, chromosome 13 at 69,629,542 bp
  • T to C, chromosome 14 at 66,057,646 bp
  • A to T, chromosome 15 at 97,980,192 bp
  • T to A, chromosome 16 at 37,992,141 bp
  • C to T, chromosome 16 at 88,562,639 bp
  • T to C, chromosome 16 at 93,900,017 bp
  • T to C, chromosome 17 at 3,695,564 bp
  • C to G, chromosome 17 at 25,943,684 bp
  • A to T, chromosome 17 at 46,439,738 bp
  • A to T, chromosome 17 at 46,938,653 bp
  • A to T, chromosome 18 at 71,809,204 bp
  • A to T, chromosome 19 at 4,197,360 bp
  • T to A, chromosome 19 at 21,409,887 bp
  • A to G, chromosome 19 at 30,549,345 bp
  • T to A, chromosome 19 at 39,309,726 bp
  • A to G, chromosome 19 at 42,727,642 bp
  • ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG to ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG, chromosome Y at 2,662,944 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0690 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038875-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.