Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0690Btlr/Mmmh
Stock Number:
038875-MU
Citation ID:
RRID:MMRRC_038875-MU
Other Names:
R0690 (G1), C57BL/6J-MtgxR0690Btlr
Major Collection:

Strain Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Del1, Col2a-1, Col2a, Col2, M100856, Rgsc856, Lpk, M100413, Rgsc413
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
St8sia1
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Synonyms: alpha-2,8-sialyltransferase, ST8Sia I, GD3S, GD3 synthase, Siat8, Siat8a, 9330109E03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20449
Homologene: 2282
Fam117b
Name: family with sequence similarity 117, member B
Synonyms: 6330416D14Rik, 2810425F24Rik, Als2cr13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72750
Homologene: 18307
Avpr1b
Name: arginine vasopressin receptor 1B
Synonyms: V3/V1b pituitary vasopressin receptor, V3/V1b, V1bR, AVPR3, V1BR, VPR3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26361
HGNC: HGNC:896
Homologene: 22678
Nucb2
Name: nucleobindin 2
Synonyms: NEFA, Calnuc, nesfatin-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53322
HGNC: HGNC:8044
Homologene: 3676
Trdmt1
Name: tRNA aspartic acid methyltransferase 1
Synonyms: Rnmt2, Dnmt2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13434
HGNC: HGNC:2977
Homologene: 3249
Slco1a5
Name: solute carrier organic anion transporter family, member 1a5
Synonyms: Oatp3, Slc21a7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108096
Homologene: 56603
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 59,958,353 bp
  • C to A, chromosome 1 at 118,844,460 bp
  • T to C, chromosome 1 at 131,600,281 bp
  • T to C, chromosome 1 at 131,674,778 bp
  • G to T, chromosome 1 at 134,876,082 bp
  • T to A, chromosome 2 at 13,544,580 bp
  • T to A, chromosome 2 at 26,391,097 bp
  • C to A, chromosome 2 at 32,800,695 bp
  • A to G, chromosome 2 at 87,033,882 bp
  • A to G, chromosome 2 at 120,062,675 bp
  • G to A, chromosome 3 at 36,189,559 bp
  • A to G, chromosome 3 at 51,493,417 bp
  • T to A, chromosome 3 at 89,220,165 bp
  • T to A, chromosome 3 at 96,805,786 bp
  • C to A, chromosome 3 at 108,414,977 bp
  • C to T, chromosome 3 at 126,438,184 bp
  • A to T, chromosome 4 at 43,646,991 bp
  • T to C, chromosome 4 at 43,674,562 bp
  • T to A, chromosome 4 at 111,657,388 bp
  • G to T, chromosome 4 at 116,099,750 bp
  • A to G, chromosome 4 at 118,569,727 bp
  • A to G, chromosome 4 at 134,316,405 bp
  • A to G, chromosome 4 at 135,788,426 bp
  • T to C, chromosome 4 at 149,982,573 bp
  • T to G, chromosome 4 at 156,174,453 bp
  • G to A, chromosome 5 at 5,663,951 bp
  • G to A, chromosome 5 at 41,762,127 bp
  • C to A, chromosome 5 at 69,566,352 bp
  • A to T, chromosome 5 at 122,367,646 bp
  • G to A, chromosome 5 at 123,351,940 bp
  • A to T, chromosome 5 at 136,161,599 bp
  • A to C, chromosome 6 at 30,505,834 bp
  • C to T, chromosome 6 at 49,048,015 bp
  • A to G, chromosome 6 at 73,129,474 bp
  • A to T, chromosome 6 at 86,394,442 bp
  • T to A, chromosome 6 at 142,268,278 bp
  • A to G, chromosome 6 at 142,829,254 bp
  • A to T, chromosome 7 at 16,786,904 bp
  • A to G, chromosome 7 at 27,242,249 bp
  • A to T, chromosome 7 at 27,985,217 bp
  • G to A, chromosome 7 at 63,938,071 bp
  • T to C, chromosome 7 at 116,535,851 bp
  • T to C, chromosome 7 at 140,704,787 bp
  • C to T, chromosome 8 at 64,074,290 bp
  • A to T, chromosome 8 at 67,501,804 bp
  • T to A, chromosome 8 at 70,764,949 bp
  • A to T, chromosome 8 at 71,367,065 bp
  • T to A, chromosome 8 at 80,613,952 bp
  • T to A, chromosome 8 at 80,800,116 bp
  • A to G, chromosome 9 at 4,427,071 bp
  • T to C, chromosome 9 at 37,746,217 bp
  • C to T, chromosome 9 at 44,795,514 bp
  • T to A, chromosome 9 at 66,386,838 bp
  • C to A, chromosome 9 at 105,653,976 bp
  • T to C, chromosome 9 at 105,709,486 bp
  • T to C, chromosome 9 at 106,028,187 bp
  • T to A, chromosome 9 at 106,846,649 bp
  • A to G, chromosome 10 at 5,033,138 bp
  • A to G, chromosome 10 at 20,970,843 bp
  • A to G, chromosome 10 at 61,726,452 bp
  • T to A, chromosome 11 at 4,682,933 bp
  • C to T, chromosome 11 at 61,342,504 bp
  • T to C, chromosome 11 at 62,584,676 bp
  • T to A, chromosome 11 at 70,453,226 bp
  • T to C, chromosome 11 at 82,961,403 bp
  • T to C, chromosome 11 at 95,833,634 bp
  • C to T, chromosome 11 at 97,021,544 bp
  • T to A, chromosome 11 at 109,969,808 bp
  • A to G, chromosome 13 at 48,586,905 bp
  • A to G, chromosome 13 at 69,629,542 bp
  • T to C, chromosome 14 at 66,057,646 bp
  • A to T, chromosome 15 at 97,980,192 bp
  • T to A, chromosome 16 at 37,992,141 bp
  • C to T, chromosome 16 at 88,562,639 bp
  • T to C, chromosome 16 at 93,900,017 bp
  • T to C, chromosome 17 at 3,695,564 bp
  • C to G, chromosome 17 at 25,943,684 bp
  • A to T, chromosome 17 at 46,439,738 bp
  • A to T, chromosome 17 at 46,938,653 bp
  • A to T, chromosome 18 at 71,809,204 bp
  • A to T, chromosome 19 at 4,197,360 bp
  • T to A, chromosome 19 at 21,409,887 bp
  • A to G, chromosome 19 at 30,549,345 bp
  • T to A, chromosome 19 at 39,309,726 bp
  • A to G, chromosome 19 at 42,727,642 bp
  • ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG to ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG, chromosome Y at 2,662,944 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0690 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038875-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.