Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0884Btlr/Mmmh
Stock Number:
039051-MU
Citation ID:
RRID:MMRRC_039051-MU
Other Names:
R0884 (G1), C57BL/6J-MtgxR0884Btlr
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Tnrc6b
Name: trinucleotide repeat containing 6b
Synonyms: A730065C02Rik, D230019K20Rik, 2700090M07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213988
VEGA: 15
Homologene: 66194
Dennd2b
Name: DENN domain containing 2B
Synonyms: 2610305K15Rik, 2010004M01Rik, St5, Denn2b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76954
Homologene: 3951
Fam53a
Name: family with sequence similarity 53, member A
Synonyms: 5430419M09Rik, DNTNP, 2410018C17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74504
Homologene: 18660
Bclaf1
Name: BCL2-associated transcription factor 1
Synonyms: 2700025J07Rik, 2810454G14Rik, 2610102K23Rik, 5730534O06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72567
Homologene: 8832
Dhx35
Name: DEAH-box helicase 35
Synonyms: Ddx35, 1200009D07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71715
Homologene: 6406
Eif4g3
Name: eukaryotic translation initiation factor 4 gamma, 3
Synonyms: eIF4GII, 1500002J22Rik, 4930523M17Rik, G1-419-52, repro8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230861
HGNC: HGNC:3298
Homologene: 2789
Cobl
Name: cordon-bleu WH2 repeat
Synonyms: C530045F18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12808
Homologene: 9058
Acbd3
Name: acyl-Coenzyme A binding domain containing 3
Synonyms: Pap7, 8430407O11Rik, Gocap1, D1Ertd10e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170760
Homologene: 11227
Cux1
Name: cut-like homeobox 1
Synonyms: Cux, CDP, Cux-1, Cutl1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13047
HGNC: HGNC:2557
Abcc4
Name: ATP-binding cassette, sub-family C member 4
Synonyms: D630049P08Rik, MOAT-B, MRP4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239273
VEGA: 14
HGNC: HGNC:55
Homologene: 74563
Rbm28
Name: RNA binding motif protein 28
Synonyms: 2810480G15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68272
Homologene: 135952
Vps39
Name: VPS39 HOPS complex subunit
Synonyms: A230065P22Rik, Vam6P, Vam6, mVam6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269338
Homologene: 41025
Syt9
Name: synaptotagmin IX
Synonyms: Sytv
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 60510
Homologene: 11062
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Bicc1
Name: BicC family RNA binding protein 1
Synonyms: Bic-C, jcpk
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83675
Homologene: 12856
Gosr1
Name: golgi SNAP receptor complex member 1
Synonyms: Cis-Golgi SNARE, GS28, GOS-28
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53334
HGNC: HGNC:4430
Homologene: 37977
Cep72
Name: centrosomal protein 72
Synonyms: 2610029E11Rik, 4933440J22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74470
VEGA: 13
Homologene: 10027
Phlpp1
Name: PH domain and leucine rich repeat protein phosphatase 1
Synonyms: Plekhe1, Phlpp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98432
Homologene: 11015
Prrg4
Name: proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)
Synonyms: TMG4, 9930111I18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228413
Homologene: 11451
Uggt1
Name: UDP-glucose glycoprotein glucosyltransferase 1
Synonyms: A930007H10Rik, C820010P03Rik, 0910001L17Rik, Ugcgl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320011
Homologene: 10586
Pde4d
Name: phosphodiesterase 4D, cAMP specific
Synonyms: dunce, Dpde3, 9630011N22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238871
HGNC: HGNC:8783
Gabarapl2
Name: GABA type A receptor associated protein like 2
Synonyms: 0610012F20Rik, Gef2, GATE-16, 2900019O08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93739
Homologene: 68550
Kcnd2
Name: potassium voltage-gated channel, Shal-related family, member 2
Synonyms: Kv4.2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16508
HGNC: HGNC:6238
Homologene: 40828
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Slc6a18
Name: solute carrier family 6 (neurotransmitter transporter), member 18
Synonyms: XT2, D630001K16Rik, Xtrp2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 22598
VEGA: 13
Homologene: 40785
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Slc35b2
Name: solute carrier family 35, member B2
Synonyms: 1110003M08Rik, PAPST1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73836
VEGA: 17
Homologene: 24504
Fer1l4
Name: fer-1 like family member 4
Synonyms: 9130402C12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74562
Homologene: 19075
Dnase1l2
Name: deoxyribonuclease 1-like 2
Synonyms: 4733401H14Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66705
HGNC: HGNC:2958
Homologene: 74391
Ac127374.1
Name: Uncharacterized protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Il4ra
Name: interleukin 4 receptor, alpha
Synonyms: IL-4 receptor alpha chain, CD124, Il4r
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16190
HGNC: HGNC:6015
Homologene: 7784
Nebl
Name: nebulette
Synonyms: Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74103
Homologene: 128431
Or1e1c
Name: olfactory receptor family 1 subfamily E member 1C
Synonyms: GA_x6K02T2P1NL-3535075-3536028, MOR135-12, Olfr376
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258924
Homologene: 133579
Ksr1
Name: kinase suppressor of ras 1
Synonyms: D11Bhm183e, B-KSR1, D11Bhm184e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16706
HGNC: HGNC:6465
Homologene: 8410
Zfp454
Name: zinc finger protein 454
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237758
Homologene: 72226
Lpcat4
Name: lysophosphatidylcholine acyltransferase 4
Synonyms: Aytl3, Agpat7, LPEAT2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99010
Homologene: 27544
Cacna2d4
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 4
Synonyms: 5730412N02Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319734
Homologene: 26544
Adam7
Name: a disintegrin and metallopeptidase domain 7
Synonyms: EAP1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11500
HGNC: HGNC:214
Homologene: 2830
Zmat4
Name: zinc finger, matrin type 4
Synonyms: 9630048M01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320158
Homologene: 81899
Adam6b
Name: a disintegrin and metallopeptidase domain 6B
Synonyms: 4930523C11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238405
Homologene: 128362
Gpnmb
Name: glycoprotein (transmembrane) nmb
Synonyms: Dchil, Osteoactivin, DC-HIL
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93695
HGNC: HGNC:4462
Homologene: 1880
Muc17
Name: mucin 17, cell surface associated
Synonyms: Muc3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666339
Homologene: 141159
Nmt2
Name: N-myristoyltransferase 2
Synonyms: hNMT-2, A930001K02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18108
HGNC: HGNC:7858
Homologene: 101539
Epsti1
Name: epithelial stromal interaction 1
Synonyms: 5033415K03Rik, BRESI1, 2310046K10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 108670
VEGA: 14
Homologene: 12630
Mup3
Name: major urinary protein 3
Synonyms: Mup-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17842
Homologene: 74304
Nfatc4
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 4
Synonyms: 3110041H08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 73181
VEGA: 14
HGNC: HGNC:7778
Homologene: 3349
Cyp2a12
Name: cytochrome P450, family 2, subfamily a, polypeptide 12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13085
Homologene: 69128
Tnnt2
Name: troponin T2, cardiac
Synonyms: Tnt, cTnT, cardiac TnT
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21956
Homologene: 68050
Bend7
Name: BEN domain containing 7
Synonyms: 1110017O21Rik, E130319B15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209645
Homologene: 17660
Or51ag1
Name: olfactory receptor family 51 subfamily AG member 1
Synonyms: GA_x6K02T2PBJ9-6221839-6220892, MOR9-2, Olfr610
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259085
Homologene: 17495
Nol7
Name: nucleolar protein 7
Synonyms: 5730556I21Rik, RARG-1, NOP27, 2210008F15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70078
VEGA: 13
Homologene: 49451
Aqp7
Name: aquaporin 7
Synonyms: AQP7L, AQPap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11832
Homologene: 48000
Hyi
Name: hydroxypyruvate isomerase (putative)
Synonyms: 2700033B16Rik, 6430559E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68180
Gje1
Name: gap junction protein, epsilon 1
Synonyms: AEY12, connexin 23, Cx23, D230044M03Rik, Gsfaey12, Gjf1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76743
Homologene: 87405
Slc35f1
Name: solute carrier family 35, member F1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215085
Homologene: 33552
Pigz
Name: phosphatidylinositol glycan anchor biosynthesis, class Z
Synonyms: F630022B06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239827
Homologene: 130742
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,175,078 bp
  • T to A, chromosome 1 at 106,389,665 bp
  • A to G, chromosome 1 at 135,842,042 bp
  • CGAGGAGGAGGAGGAGGA to CGAGGAGGAGGAGGA, chromosome 1 at 180,747,059 bp
  • A to T, chromosome 2 at 3,314,785 bp
  • A to T, chromosome 2 at 4,744,244 bp
  • A to C, chromosome 2 at 17,411,118 bp
  • G to A, chromosome 2 at 76,751,066 bp
  • A to T, chromosome 2 at 104,839,362 bp
  • A to G, chromosome 2 at 112,242,732 bp
  • A to G, chromosome 2 at 120,323,025 bp
  • T to C, chromosome 2 at 156,019,313 bp
  • T to C, chromosome 2 at 158,831,711 bp
  • C to A, chromosome 3 at 38,982,858 bp
  • T to A, chromosome 4 at 41,034,929 bp
  • T to A, chromosome 4 at 62,087,174 bp
  • T to A, chromosome 4 at 118,360,217 bp
  • C to A, chromosome 4 at 138,151,776 bp
  • A to G, chromosome 4 at 143,615,184 bp
  • T to A, chromosome 5 at 32,917,978 bp
  • T to C, chromosome 5 at 33,600,816 bp
  • T to G, chromosome 5 at 136,307,835 bp
  • T to A, chromosome 5 at 137,142,298 bp
  • A to T, chromosome 6 at 21,216,541 bp
  • A to T, chromosome 6 at 29,155,154 bp
  • T to C, chromosome 6 at 49,047,913 bp
  • C to T, chromosome 6 at 119,307,286 bp
  • T to C, chromosome 7 at 27,032,542 bp
  • C to T, chromosome 7 at 103,506,862 bp
  • A to G, chromosome 7 at 107,436,561 bp
  • A to G, chromosome 7 at 109,557,345 bp
  • A to G, chromosome 7 at 125,574,663 bp
  • A to G, chromosome 8 at 24,015,127 bp
  • A to T, chromosome 8 at 31,737,415 bp
  • A to T, chromosome 8 at 111,942,505 bp
  • C to A, chromosome 9 at 67,370,733 bp
  • G to T, chromosome 10 at 14,716,740 bp
  • A to T, chromosome 10 at 20,322,076 bp
  • A to T, chromosome 10 at 53,089,347 bp
  • A to C, chromosome 10 at 70,958,847 bp
  • A to G, chromosome 11 at 12,375,908 bp
  • A to G, chromosome 11 at 50,873,937 bp
  • A to T, chromosome 11 at 73,374,889 bp
  • A to G, chromosome 11 at 76,730,146 bp
  • A to T, chromosome 11 at 79,021,503 bp
  • A to T, chromosome 12 at 113,490,995 bp
  • T to C, chromosome 13 at 11,554,529 bp
  • G to A, chromosome 13 at 43,400,615 bp
  • G to T, chromosome 13 at 73,667,037 bp
  • A to G, chromosome 13 at 74,054,881 bp
  • A to T, chromosome 13 at 109,950,940 bp
  • A to C, chromosome 14 at 55,826,644 bp
  • A to C, chromosome 14 at 68,498,475 bp
  • A to T, chromosome 14 at 77,931,275 bp
  • A to T, chromosome 14 at 118,553,288 bp
  • ACAGCAGCAGCAGCAGCAGCAG to ACAGCAGCAGCAGCAGCAG, chromosome 15 at 80,902,555 bp
  • A to G, chromosome 16 at 31,941,976 bp
  • A to G, chromosome 17 at 24,441,880 bp
  • T to A, chromosome 17 at 45,566,825 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0884 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039051-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.