Strain Name:
Stock Number:
Citation ID:
Other Names:
R0989 (G1), C57BL/6J-MtgxR0989Btlr
Major Collection:

Gene Information

Name: talin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 70549
Homologene: 56692
Name: prepronociceptin
Synonyms: N23K, Npnc1, proorphanin, OFQ/N, N/OFQ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 18155
VEGA: 14
Homologene: 4537
Name: ectonucleotide pyrophosphatase/phosphodiesterase 2
Synonyms: Autotaxin, Npps2, PD-Ialpha, Pdnp2, ATX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 18606
Homologene: 4526
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonyms: NF kappaB1, p50 subunit of NF kappaB, p50/p105, p50, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18033
Homologene: 2971
Name: vesicle transport through interaction with t-SNAREs 1A
Synonyms: Vti1-rp2, 1110018K19Rik, 1110014F16Rik, 4921537J05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 53611
VEGA: 19
Homologene: 39963
Name: mutL homolog 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217716
VEGA: 12
Homologene: 91153
Name: importin 8
Synonyms: OM-1, 6230418K12Rik, Om1, C130009K11Rik, Ranbp8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 320727
Homologene: 48430
Name: translocating chain-associating membrane protein 1
Synonyms: TRAMP, 1810049E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 72265
Homologene: 8621
Name: polymerase (RNA) I polypeptide B
Synonyms: RPA2, RPA116, 128kDa, D630020H17Rik, Rpo1-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20017
Homologene: 7133
Name: seizure related 6 homolog like 2
Synonyms: Psk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233878
Homologene: 8237
Name: membrane integral NOTCH2 associated receptor 1
Synonyms: DD1, AF529169
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 209743
Homologene: 17782
Name: family with sequence similarity 120, member A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218236
VEGA: 13
Homologene: 8752
Name: cysteine rich transmembrane BMP regulator 1 (chordin like)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 50766
VEGA: 17
Homologene: 9510
Name: golgi membrane protein 1
Synonyms: D030064E01Rik, PSEC0257, GP73, 2310001L02Rik, Golph2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105348
VEGA: 13
Homologene: 12346
Name: prolylcarboxypeptidase (angiotensinase C)
Synonyms: 2610104A14Rik, 2510048K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72461
Homologene: 55867
Name: F-box and WD-40 domain protein 11
Synonyms: HOS, BTRCP2, BTRC2, Fbxw1b, 2310065A07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 103583
Homologene: 76444
Name: procollagen C-endopeptidase enhancer 2
Synonyms: Pcpe2, 2400001O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 76477
Homologene: 8357
Name: cadherin 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22295
Homologene: 11142
Name: nuclear receptor subfamily 3, group C, member 2
Synonyms: aldosterone receptor, Mlr, MR, mineralocorticoid receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 110784
Homologene: 121495
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56087
Homologene: 25816
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12614
VEGA: 15
Homologene: 7665
Name: gamma-aminobutyric acid (GABA) A receptor, subunit alpha 5
Synonyms: A230018I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 110886
Homologene: 20219
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: mfmi1, flamingo, EGFL2, Adgrc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 53883
Homologene: 1078
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329178
Homologene: 122243
Name: ATPase, Cu++ transporting, beta polypeptide
Synonyms: WND, Wilson protein, Atp7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11979
Homologene: 20063
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 9
Synonyms: AE4, D630024F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 240215
VEGA: 18
Homologene: 23732
Name: poly (ADP-ribose) polymerase family, member 3
Synonyms: Adprt3, PARP-3, A930002C11Rik, Adprtl3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235587
Homologene: 4005
Name: suppression of tumorigenicity 18
Synonyms: Nzf3, Myt3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240690
Homologene: 8792
Name: exostosin-like glycosyltransferase 1
Synonyms: D430033M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56219
Homologene: 3277
Name: kelch-like 33
Synonyms: EG546611
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 546611
VEGA: 14
Homologene: 52385
Name: tyrosine kinase, non-receptor, 2
Synonyms: P21cdc42Hs kinase, Ack, activated p21cdc42Hs kinase, ACK1, Pyk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 51789
Homologene: 4224
Name: TSPO associated protein 1
Synonyms: peripheral, Bzrap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 207777
Homologene: 37961
Name: zinc finger protein 2, Y-linked
Synonyms: Zfy-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 22768
Homologene: 56456
Name: acyl-Coenzyme A dehydrogenase, short/branched chain
Synonyms: 1300003O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 66885
Homologene: 1216
Name: predicted gene 4846
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226601
Homologene: 136281
Name: olfactory receptor 538
Synonyms: GA_x6K02T2PBJ9-42723314-42724246, MOR253-13P, MOR253-12P, MOR253-10P, MOR253-13P, MOR253-12P, Olfr1553-ps1, Olfr1523-ps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258201
Homologene: 110491
Name: neurogenic differentiation 2
Synonyms: Ndrf, bHLHa1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18013
Homologene: 4489
Name: complement component 4 binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12269
Name: SS nuclear autoantigen 1
Synonyms: 1190004J23Rik, 1110003H09Rik, NA14, N14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68475
Homologene: 2768
Name: olfactory receptor 552
Synonyms: GA_x6K02T2PBJ9-5323062-5324015, MOR28-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259106
Homologene: 73941
Name: tetraspanin 31
Synonyms: 2700085A14Rik, Tspan31, Sas
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67125
VEGA: 10
Homologene: 4359
Name: ribonuclease H1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 19819
VEGA: 12
Homologene: 2202
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 6,827,881 bp
  • T to A, chromosome 1 at 13,566,403 bp
  • T to C, chromosome 1 at 66,646,440 bp
  • G to A, chromosome 1 at 130,643,053 bp
  • G to A, chromosome 1 at 166,487,120 bp
  • T to C, chromosome 2 at 25,271,563 bp
  • T to G, chromosome 2 at 129,126,077 bp
  • A to C, chromosome 3 at 108,403,272 bp
  • A to G, chromosome 3 at 135,589,396 bp
  • TGCGTTGCACCGATACCGGG to TG, chromosome 4 at 134,357,677 bp
  • A to G, chromosome 5 at 124,797,938 bp
  • T to C, chromosome 6 at 148,796,682 bp
  • A to G, chromosome 7 at 57,413,809 bp
  • A to T, chromosome 7 at 92,910,216 bp
  • G to A, chromosome 7 at 102,604,483 bp
  • A to G, chromosome 7 at 126,959,844 bp
  • A to G, chromosome 7 at 131,428,544 bp
  • A to C, chromosome 7 at 140,574,287 bp
  • A to G, chromosome 8 at 22,028,694 bp
  • T to C, chromosome 8 at 77,187,564 bp
  • C to T, chromosome 9 at 67,229,454 bp
  • T to A, chromosome 9 at 89,602,035 bp
  • T to A, chromosome 9 at 95,638,723 bp
  • C to T, chromosome 9 at 106,473,082 bp
  • A to G, chromosome 10 at 60,534,510 bp
  • T to A, chromosome 10 at 127,068,327 bp
  • T to C, chromosome 11 at 32,735,149 bp
  • T to A, chromosome 11 at 87,765,823 bp
  • A to G, chromosome 11 at 98,327,979 bp
  • T to G, chromosome 12 at 28,655,572 bp
  • A to G, chromosome 12 at 85,269,395 bp
  • G to T, chromosome 13 at 48,885,743 bp
  • A to T, chromosome 13 at 59,640,183 bp
  • T to A, chromosome 14 at 50,891,822 bp
  • T to C, chromosome 14 at 65,404,868 bp
  • A to T, chromosome 15 at 54,875,759 bp
  • T to C, chromosome 15 at 86,031,279 bp
  • A to G, chromosome 16 at 32,680,358 bp
  • T to C, chromosome 17 at 78,200,944 bp
  • T to A, chromosome 18 at 36,536,867 bp
  • C to T, chromosome 19 at 55,499,229 bp
  • T to A, chromosome Y at 2,109,879 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0989 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039109-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.