Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1053Btlr/Mmmh
Stock Number:
039143-MU
Citation ID:
RRID:MMRRC_039143-MU
Other Names:
R1053 (G1), C57BL/6J-MtgxR1053Btlr
Major Collection:

Strain Information

Cds2
Name: CDP-diacylglycerol synthase 2
Synonyms: 5730460C18Rik, D2Wsu127e, 5730450N06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110911
HGNC: HGNC:1801
Homologene: 37854
Col6a1
Name: collagen, type VI, alpha 1
Synonyms: Col6a-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12833
HGNC: HGNC:2211
Homologene: 1391
Ppp1r12a
Name: protein phosphatase 1, regulatory subunit 12A
Synonyms: 1200015F06Rik, Mypt1, D10Ertd625e, 5730577I22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17931
VEGA: 10
HGNC: HGNC:7618
Homologene: 1855
Bcas3
Name: BCAS3 microtubule associated cell migration factor
Synonyms: K20D4, 1500019F07Rik, 2610028P08Rik, rudhira, breast carcinoma amplified sequence 3, Phaf2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192197
Homologene: 9778
Cald1
Name: caldesmon 1
Synonyms: 4833423D12Rik, C920027I18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109624
HGNC: HGNC:1441
Homologene: 137254
Erc1
Name: ELKS/RAB6-interacting/CAST family member 1
Synonyms: RAB6IP2B, RAB6IP2A, 5033405M01Rik, B430107L16Rik, 9630025C19Rik, Rab6ip2, Elks1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 111173
Homologene: 14229
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Zbtb14
Name: zinc finger and BTB domain containing 14
Synonyms: ZF5, Zfp161, b2b1982Clo
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22666
Homologene: 2560
Htt
Name: huntingtin
Synonyms: huntingtin, HD, htt, IT15, C430023I11Rik, Hdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Sorl1
Name: sortilin-related receptor, LDLR class A repeats-containing
Synonyms: LR11, mSorLA, 2900010L19Rik, Sorla
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20660
Homologene: 2336
Ctps1
Name: cytidine 5'-triphosphate synthase 1
Synonyms: Ctps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 51797
HGNC: HGNC:2519
Homologene: 20446
Cblb
Name: Casitas B-lineage lymphoma b
Synonyms: Cbl-b
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208650
VEGA: 16
HGNC: HGNC:1542
Homologene: 15856
Svil
Name: supervillin
Synonyms: B430302E16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225115
Homologene: 25090
Grm2
Name: glutamate receptor, metabotropic 2
Synonyms: mGluR2, 4930441L02Rik, Gprc1b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108068
HGNC: HGNC:4594
Homologene: 20229
Enam
Name: enamelin
Synonyms: abte
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13801
HGNC: HGNC:3344
Homologene: 9698
Lrp12
Name: low density lipoprotein-related protein 12
Synonyms: C820005L12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239393
Homologene: 8385
Ncoa6
Name: nuclear receptor coactivator 6
Synonyms: PRIP, ASC2, RAP250, AIB3, NRC, ASC-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56406
Homologene: 137337
Ampd3
Name: adenosine monophosphate deaminase 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11717
HGNC: HGNC:470
Homologene: 408
Fbxl4
Name: F-box and leucine-rich repeat protein 4
Synonyms: FBL5, FBL4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269514
Homologene: 8128
Jakmip1
Name: janus kinase and microtubule interacting protein 1
Synonyms: Marlin-1, 5830437M04Rik, C330021K24Rik, Gababrbp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76071
Homologene: 90789
Vwce
Name: von Willebrand factor C and EGF domains
Synonyms: 1300015B04Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71768
VEGA: 19
Homologene: 17651
Adam25
Name: ADAM metallopeptidase domain 25
Synonyms: testase 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23793
HGNC: HGNC:199
Homologene: 128364
Nup210
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54563
Homologene: 41286
Lair1
Name: leukocyte-associated Ig-like receptor 1
Synonyms: 5133400O11Rik, mLair-1, Lair-1, D7Bwg0421e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52855
Homologene: 48097
Or8b12
Name: olfactory receptor family 8 subfamily B member 12
Synonyms: GA_x6K02T2PVTD-31428850-31429782, MOR161-2, Olfr874
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258882
Homologene: 17377
Rsph3a
Name: radial spoke 3A homolog (Chlamydomonas)
Synonyms: 4930524H12Rik, 1700012G05Rik, Rshl2, Rshl2a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66832
VEGA: 17
Homologene: 12043
9230009I02Rik
Name: RIKEN cDNA 9230009I02 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 619293
Or52p2
Name: olfactory receptor family 52 subfamily P member 2
Synonyms: GA_x6K02T2PBJ9-5307445-5306498, MOR29-1, Olfr551
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258750
Homologene: 17381
Or1b1
Name: olfactory receptor family 1 subfamily B member 1
Synonyms: GA_x6K02T2NLDC-33797415-33796462, MOR158-1, Olfr362
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259053
HGNC: HGNC:8181
Homologene: 17479
AC147806.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
Zc2hc1c
Name: zinc finger, C2HC-type containing 1C
Synonyms: 2810002I04Rik, Fam164c
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72350
Homologene: 23461
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CAGAGAGA to CAGAGAGAGA, chromosome 1 at 85,577,224 bp
  • T to C, chromosome 2 at 37,105,464 bp
  • T to A, chromosome 2 at 132,305,260 bp
  • C to T, chromosome 2 at 155,434,040 bp
  • T to A, chromosome 4 at 22,427,166 bp
  • A to G, chromosome 4 at 120,543,722 bp
  • A to G, chromosome 5 at 34,851,217 bp
  • A to G, chromosome 5 at 37,134,249 bp
  • A to G, chromosome 5 at 88,504,019 bp
  • G to T, chromosome 6 at 34,755,642 bp
  • T to C, chromosome 6 at 91,028,811 bp
  • T to C, chromosome 6 at 119,796,926 bp
  • A to G, chromosome 7 at 4,028,785 bp
  • A to T, chromosome 7 at 102,587,959 bp
  • G to A, chromosome 7 at 110,788,680 bp
  • A to T, chromosome 8 at 40,754,731 bp
  • T to C, chromosome 9 at 37,746,835 bp
  • T to C, chromosome 9 at 41,991,456 bp
  • T to G, chromosome 9 at 106,648,157 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to T, chromosome 10 at 76,720,966 bp
  • T to C, chromosome 10 at 108,262,351 bp
  • A to G, chromosome 11 at 51,091,409 bp
  • T to A, chromosome 11 at 85,557,410 bp
  • A to G, chromosome 11 at 99,858,061 bp
  • A to G, chromosome 12 at 85,296,556 bp
  • A to G, chromosome 15 at 35,652,363 bp
  • A to C, chromosome 15 at 39,877,981 bp
  • T to C, chromosome 16 at 52,194,144 bp
  • C to A, chromosome 17 at 7,945,904 bp
  • C to A, chromosome 17 at 69,388,502 bp
  • C to G, chromosome 18 at 5,056,690 bp
  • T to C, chromosome 19 at 10,664,099 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1053 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039143-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.