Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1163Btlr/Mmmh
Stock Number:
039236-MU
Citation ID:
RRID:MMRRC_039236-MU
Other Names:
R1163 (G1), C57BL/6J-MtgxR1163Btlr
Major Collection:

Strain Information

Gon4l
Name: gon-4 like
Synonyms: 1500041I23Rik, 2610100B20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76022
Homologene: 13002
Psmd13
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Synonyms: S11, 26S proteasome subunit p40.5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23997
HGNC: HGNC:9558
Homologene: 2110
Rnd1
Name: Rho family GTPase 1
Synonyms: Arhs, A830014L09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223881
Homologene: 8706
B3gnt2
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Synonyms: B3Galt6, B3gnt1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53625
Homologene: 4797
Kif11
Name: kinesin family member 11
Synonyms: Eg5, Knsl1, Kifl1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16551
VEGA: 19
HGNC: HGNC:6388
Homologene: 3322
Dpp3
Name: dipeptidylpeptidase 3
Synonyms: 4930533O14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 75221
VEGA: 19
HGNC: HGNC:3008
Homologene: 40210
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 38,871,702 bp
  • A to G, chromosome 1 at 60,343,468 bp
  • C to T, chromosome 1 at 72,688,705 bp
  • T to C, chromosome 1 at 173,924,137 bp
  • A to T, chromosome 2 at 37,147,027 bp
  • G to A, chromosome 2 at 39,107,200 bp
  • T to C, chromosome 2 at 65,098,279 bp
  • A to T, chromosome 2 at 86,483,238 bp
  • A to G, chromosome 2 at 86,978,676 bp
  • G to T, chromosome 2 at 89,930,105 bp
  • A to T, chromosome 2 at 92,422,253 bp
  • G to A, chromosome 2 at 120,696,213 bp
  • A to G, chromosome 2 at 122,070,941 bp
  • A to T, chromosome 2 at 174,457,739 bp
  • T to C, chromosome 3 at 64,086,625 bp
  • T to C, chromosome 3 at 88,892,535 bp
  • G to T, chromosome 3 at 89,035,263 bp
  • T to G, chromosome 3 at 138,176,510 bp
  • A to G, chromosome 3 at 142,599,096 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG, chromosome 4 at 22,487,697 bp
  • A to G, chromosome 4 at 106,420,960 bp
  • G to T, chromosome 4 at 125,072,820 bp
  • A to T, chromosome 4 at 129,725,586 bp
  • A to G, chromosome 4 at 143,656,634 bp
  • T to A, chromosome 4 at 154,011,817 bp
  • T to A, chromosome 5 at 9,570,738 bp
  • T to A, chromosome 5 at 21,899,029 bp
  • T to A, chromosome 5 at 121,493,756 bp
  • G to T, chromosome 5 at 142,960,843 bp
  • A to T, chromosome 5 at 145,002,416 bp
  • A to T, chromosome 5 at 149,630,801 bp
  • A to T, chromosome 6 at 38,029,700 bp
  • G to A, chromosome 6 at 42,744,123 bp
  • A to G, chromosome 6 at 100,637,072 bp
  • G to A, chromosome 6 at 112,459,935 bp
  • A to G, chromosome 6 at 126,864,787 bp
  • A to G, chromosome 7 at 13,178,133 bp
  • A to G, chromosome 7 at 18,565,309 bp
  • G to A, chromosome 7 at 23,320,972 bp
  • T to A, chromosome 7 at 23,808,512 bp
  • T to G, chromosome 7 at 30,765,051 bp
  • A to T, chromosome 7 at 47,981,476 bp
  • A to T, chromosome 7 at 65,323,054 bp
  • T to C, chromosome 7 at 79,729,971 bp
  • T to A, chromosome 7 at 123,331,279 bp
  • C to A, chromosome 7 at 140,897,454 bp
  • T to C, chromosome 8 at 79,992,476 bp
  • A to G, chromosome 9 at 14,551,756 bp
  • A to T, chromosome 9 at 86,440,595 bp
  • A to T, chromosome 9 at 104,055,826 bp
  • A to T, chromosome 9 at 119,058,531 bp
  • A to T, chromosome 9 at 119,533,927 bp
  • C to T, chromosome 10 at 18,783,721 bp
  • T to A, chromosome 10 at 87,121,422 bp
  • T to C, chromosome 10 at 98,979,851 bp
  • G to A, chromosome 10 at 128,438,207 bp
  • A to G, chromosome 10 at 129,625,647 bp
  • A to T, chromosome 11 at 16,883,546 bp
  • A to G, chromosome 11 at 20,240,539 bp
  • A to T, chromosome 11 at 22,836,558 bp
  • A to G, chromosome 11 at 24,165,143 bp
  • A to T, chromosome 11 at 50,779,714 bp
  • T to C, chromosome 11 at 61,703,436 bp
  • C to G, chromosome 11 at 87,729,513 bp
  • A to G, chromosome 11 at 98,650,858 bp
  • T to C, chromosome 11 at 110,071,530 bp
  • C to T, chromosome 11 at 114,710,888 bp
  • A to G, chromosome 12 at 4,712,009 bp
  • A to G, chromosome 12 at 8,011,654 bp
  • A to T, chromosome 12 at 104,239,292 bp
  • T to C, chromosome 12 at 112,179,945 bp
  • T to C, chromosome 13 at 47,071,922 bp
  • G to A, chromosome 13 at 92,682,777 bp
  • A to G, chromosome 15 at 74,980,144 bp
  • G to T, chromosome 15 at 76,183,838 bp
  • G to A, chromosome 15 at 88,820,631 bp
  • A to T, chromosome 15 at 98,676,554 bp
  • C to A, chromosome 15 at 101,848,165 bp
  • T to G, chromosome 16 at 14,394,095 bp
  • A to G, chromosome 16 at 32,506,440 bp
  • A to T, chromosome 16 at 35,628,096 bp
  • G to A, chromosome 16 at 35,839,406 bp
  • A to T, chromosome 16 at 36,494,807 bp
  • G to T, chromosome 16 at 36,916,126 bp
  • A to G, chromosome 16 at 44,838,020 bp
  • A to T, chromosome 16 at 45,392,352 bp
  • A to G, chromosome 16 at 59,269,155 bp
  • A to T, chromosome 16 at 59,345,062 bp
  • G to C, chromosome 16 at 85,802,637 bp
  • G to A, chromosome 17 at 24,892,918 bp
  • T to C, chromosome 17 at 34,060,645 bp
  • T to C, chromosome 17 at 34,470,075 bp
  • C to T, chromosome 17 at 37,195,321 bp
  • T to C, chromosome 17 at 46,251,229 bp
  • C to A, chromosome 17 at 56,199,426 bp
  • A to T, chromosome 17 at 79,659,451 bp
  • A to T, chromosome 18 at 73,648,907 bp
  • A to T, chromosome 19 at 4,006,447 bp
  • C to T, chromosome 19 at 4,914,923 bp
  • A to T, chromosome 19 at 5,104,656 bp
  • T to A, chromosome 19 at 12,890,149 bp
  • A to G, chromosome 19 at 25,051,503 bp
  • A to T, chromosome 19 at 32,634,009 bp
  • A to T, chromosome 19 at 37,390,298 bp
  • G to A, chromosome Y at 725,611 bp
  • G to A, chromosome Y at 898,029 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1163 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039236-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.