Strain Name:
C57BL/6J-MtgxR1163Btlr/Mmmh
Stock Number:
039236-MU
Citation ID:
RRID:MMRRC_039236-MU
Other Names:
R1163 (G1), C57BL/6J-MtgxR1163Btlr
Major Collection:

Strain Information

Ifi203
Name: interferon activated gene 203
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 15950
Homologene: 115929
Gon4l
Name: gon-4-like (C.elegans)
Synonyms: 2610100B20Rik, 1500041I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 76022
Homologene: 13002
Psmd13
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Synonyms: 26S proteasome subunit p40.5, S11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 23997
HGNC: HGNC:9558
Homologene: 2110
Rnd1
Name: Rho family GTPase 1
Synonyms: Arhs, A830014L09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223881
Homologene: 8706
B3gnt2
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Synonyms: B3Galt6, B3gnt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 53625
Homologene: 4797
Kif11
Name: kinesin family member 11
Synonyms: Kifl1, Knsl1, Eg5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 16551
VEGA: 19
HGNC: HGNC:6388
Homologene: 3322
Dpp3
Name: dipeptidylpeptidase 3
Synonyms: 4930533O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 75221
VEGA: 19
HGNC: HGNC:3008
Homologene: 40210
Cep68
Name: centrosomal protein 68
Synonyms: 6030463E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216543
Homologene: 65235
Usp24
Name: ubiquitin specific peptidase 24
Synonyms: 2700066K03Rik, 2810030C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329908
Homologene: 35420
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: 8030453L17Rik, E430018P19Rik, KMT2H, chromatin remodeling factor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 192195
Homologene: 10225
Hsph1
Name: heat shock 105kDa/110kDa protein 1
Synonyms: HSP110, hsp-E7I, hsp110/105, Hsp105
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 15505
Homologene: 21322
Amotl1
Name: angiomotin-like 1
Synonyms: 4932416D09Rik, JEAP, 2310067L22Rik, 2310010G08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75723
Homologene: 43977
Casr
Name: calcium-sensing receptor
Synonyms: CaR, cation sensing receptor, Gprc2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12374
HGNC: HGNC:1514
Homologene: 332
Kif26a
Name: kinesin family member 26A
Synonyms: N-11 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 668303
Homologene: 18970
Apob
Name: apolipoprotein B
Synonyms: apob-48, apob-100
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Tjp1
Name: tight junction protein 1
Synonyms: ZO1, ZO-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21872
Homologene: 2445
Atp2b1
Name: ATPase, Ca++ transporting, plasma membrane 1
Synonyms: 2810442I22Rik, PMCA1, E130111D10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67972
VEGA: 10
HGNC: HGNC:814
Homologene: 55597
Spg11
Name: SPG11, spatacsin vesicle trafficking associated
Synonyms: C530005A01Rik, 6030465E24Rik, spastic paraplegia 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 214585
Homologene: 41614
Arhgap17
Name: Rho GTPase activating protein 17
Synonyms: Rich1, Nadrin2, Nadrin, WBP15, 5730403H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 70497
Homologene: 9984
Serinc5
Name: serine incorporator 5
Synonyms: AIGP3, A130038L21Rik, TPO1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218442
VEGA: 13
Homologene: 65246
Egfr
Name: epidermal growth factor receptor
Synonyms: 9030024J15Rik, Errb1, Erbb, avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13649
HGNC: HGNC:3236
Homologene: 74545
Creld2
Name: cysteine-rich with EGF-like domains 2
Synonyms: 5730592L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 76737
VEGA: 15
Homologene: 11526
Dmkn
Name: dermokine
Synonyms: Dmkn, dermokine, cI-36, sk30, 1110014F24Rik, sk89
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 73712
Homologene: 136295
Hhip
Name: Hedgehog-interacting protein
Synonyms: Hhip1, Hip1, Hip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 15245
Homologene: 32469
Zfy1
Name: zinc finger protein 1, Y-linked
Synonyms: Zfy-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 22767
Homologene: 56456
Khdrbs1
Name: KH domain containing, RNA binding, signal transduction associated 1
Synonyms: Sam68, p62
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 20218
Homologene: 4781
Smad4
Name: SMAD family member 4
Synonyms: Madh4, DPC4, Dpc4, Smad 4, D18Wsu70e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17128
HGNC: HGNC:6770
Homologene: 31310
Itsn2
Name: intersectin 2
Synonyms: Sh3d1B, Ese2, Eh domain, SH3 domain regulator of endocytosis 2, Sh3p18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Rnf41
Name: ring finger protein 41
Synonyms: 4933415P08Rik, D10Ertd722e, 2210404G21Rik, FLRF, Nrdp1, 4930511A05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67588
VEGA: 10
Homologene: 4226
Ube3d
Name: ubiquitin protein ligase E3D
Synonyms: Ube2cbp, 2610018I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 70348
Homologene: 18898
Shq1
Name: SHQ1 homolog (S. cerevisiae)
Synonyms: Grim-1, 2810403P18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 72171
Homologene: 31683
Eme2
Name: essential meiotic structure-specific endonuclease subunit 2
Synonyms: 2810013J18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 193838
Homologene: 19180
Lrrc47
Name: leucine rich repeat containing 47
Synonyms: 2900010D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 72946
Homologene: 10795
Cyp20a1
Name: cytochrome P450, family 20, subfamily a, polypeptide 1
Synonyms: A930011N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 77951
Homologene: 18584
Dpp9
Name: dipeptidylpeptidase 9
Synonyms: DPRP2, 6430584G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224897
VEGA: 17
Homologene: 16385
Doc2g
Name: double C2, gamma
Synonyms: D830013O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 60425
Homologene: 11036
Dock8
Name: dedicator of cytokinesis 8
Synonyms: 5830472H07Rik, 1200017A24Rik, A130095G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 76088
VEGA: 19
Homologene: 52414
Chst10
Name: carbohydrate sulfotransferase 10
Synonyms: ST, Hnk-1st
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98388
Homologene: 21013
Reln
Name: reelin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19699
HGNC: HGNC:9957
Homologene: 3699
Akap3
Name: A kinase (PRKA) anchor protein 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11642
HGNC: HGNC:373
Homologene: 4688
Col11a2
Name: collagen, type XI, alpha 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12815
HGNC: HGNC:2187
Homologene: 22547
Kdm5d
Name: lysine (K)-specific demethylase 5D
Synonyms: Jarid1d, HY, Smcy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 20592
Homologene: 55838
4930579F01Rik
Name: RIKEN cDNA 4930579F01 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67741
Homologene: 12962
Tmem116
Name: transmembrane protein 116
Synonyms: 4930406A18Rik, C030022K24Rik, 4930513P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 77462
Homologene: 12676
Scn5a
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: SkM2, mH1, Nav1.5, Nav1.5c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20271
Homologene: 22738
Stard9
Name: START domain containing 9
Synonyms: Kif16a, N-3 kinesin, 4831403C07Rik, E230025N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668880
Homologene: 130712
Kpna7
Name: karyopherin subunit alpha 7
Synonyms: LOC381686, importin alpha 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381686
Homologene: 73467
Grm3
Name: glutamate receptor, metabotropic 3
Synonyms: mGlu3, Gprc1c, mGluR3, 0710001G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 108069
HGNC: HGNC:4595
Homologene: 651
Uba5
Name: ubiquitin-like modifier activating enzyme 5
Synonyms: 5730525G14Rik, Ube1dc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66663
Homologene: 11738
Vmn2r1
Name: vomeronasal 2, receptor 1
Synonyms: V2r83, EG56544
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 56544
Homologene: 84832
Fscn1
Name: fascin actin-bundling protein 1
Synonyms: fascin-1, Fan1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14086
Homologene: 48164
Serpina3g
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3G
Synonyms: 2A2, alpha-1 antiproteinase,, Spi2/eb.1, Spi2-1, Spi2A, alpha-1 antiproteinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20715
HGNC: HGNC:16
Homologene: 115927
Or5ac19
Name: olfactory receptor family 5 subfamily AC member 19
Synonyms: GA_x54KRFPKG5P-55483936-55483010, Olfr201, MOR182-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 258996
Homologene: 37011
Ankar
Name: ankyrin and armadillo repeat containing
Synonyms: 4932422E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319695
Homologene: 85163
Adamts2
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2
Synonyms: ADAM-TS2, hPCPNI, procollagen N-proteinase, a disintegrin and metalloproteinase with thrombospondin repeats
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216725
HGNC: HGNC:218
Homologene: 8597
Kdm1b
Name: lysine (K)-specific demethylase 1B
Synonyms: Aof1, 4632428N09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218214
Homologene: 14695
Rmdn2
Name: regulator of microtubule dynamics 2
Synonyms: Fam82a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 381110
VEGA: 17
Homologene: 71930
Snip1
Name: Smad nuclear interacting protein 1
Synonyms: 2410133M08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 76793
Homologene: 110886
Abca8a
Name: ATP-binding cassette, sub-family A (ABC1), member 8a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Golgb1
Name: golgin B1
Synonyms: 6330407A06Rik, F730017E11Rik, Giantin, Gm6840, C130074L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224139
HGNC: HGNC:4429
Homologene: 68401
Yipf3
Name: Yip1 domain family, member 3
Synonyms: D17Wsu94e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 28064
Homologene: 9117
Or4c10
Name: olfactory receptor family 4 subfamily C member 10
Synonyms: MOR232-3, GA_x6K02T2Q125-51361752-51362687, Olfr1258
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258980
Homologene: 82299
Ttyh2
Name: tweety family member 2
Synonyms: 1110001A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 117160
Homologene: 41882
Papss2
Name: 3'-phosphoadenosine 5'-phosphosulfate synthase 2
Synonyms: Sk2, 1810018P12Rik, Atpsk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 23972
VEGA: 19
HGNC: HGNC:8604
Homologene: 55840
Sema5b
Name: sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B
Synonyms: SemG, Semag, SemG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 20357
Homologene: 8427
Or8h10
Name: olfactory receptor family 8 subfamily H member 10
Synonyms: Olfr1100, GA_x6K02T2Q125-48465387-48464422, MOR206-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258587
Homologene: 34954
Adamts1
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 1
Synonyms: METH-1, ADAM-TS1, METH1, ADAMTS-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 11504
HGNC: HGNC:217
Homologene: 21381
Gsdma2
Name: gasdermin A2
Synonyms: 2210009F20Rik, 2210006M16Rik, Gsdml2, 2210411P14Rik, Gsdm2, 2200001G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76758
Tubb1
Name: tubulin, beta 1 class VI
Synonyms: 2810484G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 545486
Homologene: 69474
Pou3f2
Name: POU domain, class 3, transcription factor 2
Synonyms: A230098E07Rik, Otf7, 9430075J19Rik, Brn2, Brn-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18992
HGNC: HGNC:9215
Homologene: 4095
Gm4922
Name: predicted gene 4922
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237300
VEGA: 10
Homologene: 50497
Or5b96
Name: olfactory receptor family 5 subfamily B member 96
Synonyms: MOR202-2, Olfr1446, GA_x6K02T2RE5P-3220047-3219130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258699
HGNC: HGNC:8324
Homologene: 74233
Rnf43
Name: ring finger protein 43
Synonyms: 4732452J19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 207742
Homologene: 37742
Scai
Name: suppressor of cancer cell invasion
Synonyms: A930041I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 320271
Homologene: 15523
Or8k41
Name: olfactory receptor family 8 subfamily K member 41
Synonyms: GA_x6K02T2Q125-47962802-47962551, MOR189-3, GA_x6K02T0101M-139-669, Olfr228, Olfr1071
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258400
Homologene: 17233
1700113H08Rik
Name: RIKEN cDNA 1700113H08 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 76640
Homologene: 45695
Svopl
Name: SV2 related protein homolog (rat)-like
Synonyms: 9430071P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 320590
Homologene: 52168
Vill
Name: villin-like
Synonyms: Villp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22351
Homologene: 22650
Parp14
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: CoaSt6, collaborator of Stat6, 1600029O10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 547253
Homologene: 19697
Abcc1
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Synonyms: MRP, Mdrap, Abcc1a, Abcc1b, Mrp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17250
HGNC: HGNC:51
Homologene: 133779
Cobll1
Name: Cobl-like 1
Synonyms: Coblr1, D430044D16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 319876
Homologene: 8933
Gbp2b
Name: guanylate binding protein 2b
Synonyms: Gbp1, Mpa1, Gbp-1, Mag-1, Mpa-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14468
HGNC: HGNC:4183
Homologene: 137233
Mrgpra4
Name: MAS-related GPR, member A4
Synonyms: MrgA4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 235854
Homologene: 131159
Fam83g
Name: family with sequence similarity 83, member G
Synonyms: 2310040C09Rik, wly
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69640
Homologene: 85169
Nlrp4e
Name: NLR family, pyrin domain containing 4E
Synonyms: Nalp4e, 4930406H16Rik, Nalp-epsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 446099
Homologene: 75315
Plin1
Name: perilipin 1
Synonyms: Plin, 6030432J05Rik, perilipin B, perilipin A, Peri
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 103968
HGNC: HGNC:9076
Homologene: 2001
Psg27
Name: pregnancy-specific beta-1-glycoprotein 27
Synonyms: EG545925, cea15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 545925
Homologene: 110989
Cd200
Name: CD200 molecule
Synonyms: OX2, Mox2, MRC OX-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17470
HGNC: HGNC:7203
Homologene: 4344
Krt1
Name: keratin 1
Synonyms: Krt-2.1, Krt2-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Rab1b
Name: RAB1B, member RAS oncogene family
Synonyms: 1110011F09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 76308
VEGA: 19
Homologene: 128838
Btnl4
Name: butyrophilin-like 4
Synonyms: EG632126, NG11, Btn3a3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 632126
Homologene: 106849
Or1l4b
Name: olfactory receptor family 1 subfamily L member 4B
Synonyms: GA_x6K02T2NLDC-33831282-33832243, Olfr364, MOR138-7, MOR138-4P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227794
Cry2
Name: cryptochrome 2 (photolyase-like)
Synonyms: D130054K12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12953
HGNC: HGNC:2385
Homologene: 56466
Or6c66
Name: olfactory receptor family 6 subfamily C member 66
Synonyms: GA_x6K02T2PULF-11304679-11303744, MOR108-1, Olfr798
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258549
Homologene: 133881
Bcl11a
Name: B cell CLL/lymphoma 11A (zinc finger protein)
Synonyms: Evi9c, Evi9a, D930021L15Rik, CTIP1, Evi9, COUP-TF interacting protein 1, mouse myeloid leukemia gene, 2810047E18Rik, Evi9b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14025
Homologene: 11284
Cav3
Name: caveolin 3
Synonyms: M-caveolin, Cav-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12391
HGNC: HGNC:1529
Homologene: 7255
Or2f1
Name: olfactory receptor family 2 subfamily F member 1
Synonyms: GA_x6K02T2P3E9-4815856-4814903, Olfr453, MOR257-8P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258016
HGNC: HGNC:8246
Homologene: 128151
Vmn1r88
Name: vomeronasal 1 receptor, 88
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100312474
Homologene: 74345
Vmn1r175
Name: vomeronasal 1 receptor 175
Synonyms: Gm6299
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 622222
Homologene: 128341
Ly6i
Name: lymphocyte antigen 6 family member I
Synonyms: Ly-6I, Ly-6M
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 57248
HGNC: HGNC:6728
Homologene: 113718
Zdhhc19
Name: zinc finger, DHHC domain containing 19
Synonyms: LOC245308
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 245308
Homologene: 34922
Cd200r4
Name: CD200 receptor 4
Synonyms: F630107N04Rik, MCD200RLa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239849
Homologene: 45557
Or5ac24
Name: olfactory receptor family 5 subfamily AC member 24
Synonyms: Olfr206, MOR182-4, GA_x54KRFPKG5P-55560552-55559632
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 258993
Homologene: 74262
Ubd
Name: ubiquitin D
Synonyms: FAT10, Diubiquitin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 24108
Homologene: 4665
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 38,871,702 bp
  • A to G, chromosome 1 at 60,343,468 bp
  • C to T, chromosome 1 at 72,688,705 bp
  • T to C, chromosome 1 at 173,924,137 bp
  • A to T, chromosome 2 at 37,147,027 bp
  • G to A, chromosome 2 at 39,107,200 bp
  • T to C, chromosome 2 at 65,098,279 bp
  • A to T, chromosome 2 at 86,483,238 bp
  • A to G, chromosome 2 at 86,978,676 bp
  • G to T, chromosome 2 at 89,930,105 bp
  • A to T, chromosome 2 at 92,422,253 bp
  • G to A, chromosome 2 at 120,696,213 bp
  • A to G, chromosome 2 at 122,070,941 bp
  • A to T, chromosome 2 at 174,457,739 bp
  • T to C, chromosome 3 at 64,086,625 bp
  • T to C, chromosome 3 at 88,892,535 bp
  • G to T, chromosome 3 at 89,035,263 bp
  • T to G, chromosome 3 at 138,176,510 bp
  • A to G, chromosome 3 at 142,599,096 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG, chromosome 4 at 22,487,697 bp
  • A to G, chromosome 4 at 106,420,960 bp
  • G to T, chromosome 4 at 125,072,820 bp
  • A to T, chromosome 4 at 129,725,586 bp
  • A to G, chromosome 4 at 143,656,634 bp
  • T to A, chromosome 4 at 154,011,817 bp
  • T to A, chromosome 5 at 9,570,738 bp
  • T to A, chromosome 5 at 21,899,029 bp
  • T to A, chromosome 5 at 121,493,756 bp
  • G to T, chromosome 5 at 142,960,843 bp
  • A to T, chromosome 5 at 145,002,416 bp
  • A to T, chromosome 5 at 149,630,801 bp
  • A to T, chromosome 6 at 38,029,700 bp
  • G to A, chromosome 6 at 42,744,123 bp
  • A to G, chromosome 6 at 100,637,072 bp
  • G to A, chromosome 6 at 112,459,935 bp
  • A to G, chromosome 6 at 126,864,787 bp
  • A to G, chromosome 7 at 13,178,133 bp
  • A to G, chromosome 7 at 18,565,309 bp
  • G to A, chromosome 7 at 23,320,972 bp
  • T to A, chromosome 7 at 23,808,512 bp
  • T to G, chromosome 7 at 30,765,051 bp
  • A to T, chromosome 7 at 47,981,476 bp
  • A to T, chromosome 7 at 65,323,054 bp
  • T to C, chromosome 7 at 79,729,971 bp
  • T to A, chromosome 7 at 123,331,279 bp
  • C to A, chromosome 7 at 140,897,454 bp
  • T to C, chromosome 8 at 79,992,476 bp
  • A to G, chromosome 9 at 14,551,756 bp
  • A to T, chromosome 9 at 86,440,595 bp
  • A to T, chromosome 9 at 104,055,826 bp
  • A to T, chromosome 9 at 119,058,531 bp
  • A to T, chromosome 9 at 119,533,927 bp
  • C to T, chromosome 10 at 18,783,721 bp
  • T to A, chromosome 10 at 87,121,422 bp
  • T to C, chromosome 10 at 98,979,851 bp
  • G to A, chromosome 10 at 128,438,207 bp
  • A to G, chromosome 10 at 129,625,647 bp
  • A to T, chromosome 11 at 16,883,546 bp
  • A to G, chromosome 11 at 20,240,539 bp
  • A to T, chromosome 11 at 22,836,558 bp
  • A to G, chromosome 11 at 24,165,143 bp
  • A to T, chromosome 11 at 50,779,714 bp
  • T to C, chromosome 11 at 61,703,436 bp
  • C to G, chromosome 11 at 87,729,513 bp
  • A to G, chromosome 11 at 98,650,858 bp
  • T to C, chromosome 11 at 110,071,530 bp
  • C to T, chromosome 11 at 114,710,888 bp
  • A to G, chromosome 12 at 4,712,009 bp
  • A to G, chromosome 12 at 8,011,654 bp
  • A to T, chromosome 12 at 104,239,292 bp
  • T to C, chromosome 12 at 112,179,945 bp
  • T to C, chromosome 13 at 47,071,922 bp
  • G to A, chromosome 13 at 92,682,777 bp
  • A to G, chromosome 15 at 74,980,144 bp
  • G to T, chromosome 15 at 76,183,838 bp
  • G to A, chromosome 15 at 88,820,631 bp
  • A to T, chromosome 15 at 98,676,554 bp
  • C to A, chromosome 15 at 101,848,165 bp
  • T to G, chromosome 16 at 14,394,095 bp
  • A to G, chromosome 16 at 32,506,440 bp
  • A to T, chromosome 16 at 35,628,096 bp
  • G to A, chromosome 16 at 35,839,406 bp
  • A to T, chromosome 16 at 36,494,807 bp
  • G to T, chromosome 16 at 36,916,126 bp
  • A to G, chromosome 16 at 44,838,020 bp
  • A to T, chromosome 16 at 45,392,352 bp
  • A to G, chromosome 16 at 59,269,155 bp
  • A to T, chromosome 16 at 59,345,062 bp
  • G to C, chromosome 16 at 85,802,637 bp
  • G to A, chromosome 17 at 24,892,918 bp
  • T to C, chromosome 17 at 34,060,645 bp
  • T to C, chromosome 17 at 34,470,075 bp
  • C to T, chromosome 17 at 37,195,321 bp
  • T to C, chromosome 17 at 46,251,229 bp
  • C to A, chromosome 17 at 56,199,426 bp
  • A to T, chromosome 17 at 79,659,451 bp
  • A to T, chromosome 18 at 73,648,907 bp
  • A to T, chromosome 19 at 4,006,447 bp
  • C to T, chromosome 19 at 4,914,923 bp
  • A to T, chromosome 19 at 5,104,656 bp
  • T to A, chromosome 19 at 12,890,149 bp
  • A to G, chromosome 19 at 25,051,503 bp
  • A to T, chromosome 19 at 32,634,009 bp
  • A to T, chromosome 19 at 37,390,298 bp
  • G to A, chromosome Y at 725,611 bp
  • G to A, chromosome Y at 898,029 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1163 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039236-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.