Strain Name:
C57BL/6J-MtgxR1167Btlr/Mmmh
Stock Number:
039240-MU
Citation ID:
RRID:MMRRC_039240-MU
Other Names:
R1167 (G1), C57BL/6J-MtgxR1167Btlr
Major Collection:

Strain Information

Sbf2
Name: SET binding factor 2
Synonyms: SBF2, 4833411B01Rik, mMTMH1, B430219L04Rik, Mtmr13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag, Bpag1, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: 2610509D04Rik, Ggtb3, Bwf1, D5Ertd66e, Bchs, Alfy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 72145
Homologene: 22855
Net1
Name: neuroepithelial cell transforming gene 1
Synonyms: mNET1, Net1 homolog, 9530071N24Rik, 0610025H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 56349
VEGA: 13
Homologene: 4283
Rab1a
Name: RAB1A, member RAS oncogene family
Synonyms: ras-related YPT1 protein, Ypt1, Rab-1, Gtbp, Rab1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19324
HGNC: HGNC:9758
Homologene: 36154
Clptm1
Name: cleft lip and palate associated transmembrane protein 1
Synonyms: N14, HS9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56457
HGNC: HGNC:2087
Homologene: 37464
Coro7
Name: coronin 7
Synonyms: 0610011B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 78885
Homologene: 11573
Slc8a2
Name: solute carrier family 8 (sodium/calcium exchanger), member 2
Synonyms: Ncx2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 110891
Homologene: 27358
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 23964
Homologene: 22672
Gga1
Name: golgi associated, gamma adaptin ear containing, ARF binding protein 1
Synonyms: 4930406E12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 106039
VEGA: 15
Homologene: 39250
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Adnp
Name: activity-dependent neuroprotective protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11538
Homologene: 7617
Wwc2
Name: WW, C2 and coiled-coil domain containing 2
Synonyms: D8Ertd594e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 52357
Homologene: 32618
Rassf3
Name: Ras association (RalGDS/AF-6) domain family member 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 192678
VEGA: 10
Homologene: 16365
Cep135
Name: centrosomal protein 135
Synonyms: LOC381644, Cep4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381644
Homologene: 45709
Bmpr2
Name: bone morphogenetic protein receptor, type II (serine/threonine kinase)
Synonyms: BMPR-II, BMP-2, 2610024H22Rik, BMPRII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12168
HGNC: HGNC:1078
Homologene: 929
Rho
Name: rhodopsin
Synonyms: Red Opsin, L opsin, LWS opsin, Long Wavelength Sensitive opsin, Rod Opsin, RP4, Opn2, opsin 2, Ops, Noerg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 212541
Homologene: 68068
Robo3
Name: roundabout guidance receptor 3
Synonyms: Rig-1, Rbig1, Robo3b, Robo3a, Rig1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19649
Homologene: 32119
Pop4
Name: processing of precursor 4, ribonuclease P/MRP family, (S. cerevisiae)
Synonyms: Rpp29, 1110023P21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 66161
Homologene: 31392
Cyc1
Name: cytochrome c-1
Synonyms: 2610002H19Rik, Cyct1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66445
VEGA: 15
HGNC: HGNC:2579
Homologene: 55617
Ola1
Name: Obg-like ATPase 1
Synonyms: 2810405J23Rik, 2510025G09Rik, 2810409H07Rik, Gtpbp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67059
Homologene: 5361
Edrf1
Name: erythroid differentiation regulatory factor 1
Synonyms: 2700050L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 214764
Homologene: 27985
Pbrm1
Name: polybromo 1
Synonyms: BAF180, 2610016F04Rik, 2310032M22Rik, Pb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66923
Homologene: 10044
Rnft2
Name: ring finger protein, transmembrane 2
Synonyms: B830028P19Rik, Tmem118
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 269695
Homologene: 41892
Dnmt3c
Name: DNA methyltransferase 3C
Synonyms: Gm14490, Dnmt3c-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668932
Kcnv1
Name: potassium channel, subfamily V, member 1
Synonyms: 2700023A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 67498
VEGA: 15
Homologene: 22811
Acr
Name: acrosin prepropeptide
Synonyms: preproacrosin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11434
VEGA: 15
HGNC: HGNC:126
Homologene: 855
Spats2l
Name: spermatogenesis associated, serine-rich 2-like
Synonyms: A230104H11Rik, 2810022L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67198
Homologene: 56711
Tnfsf8
Name: tumor necrosis factor (ligand) superfamily, member 8
Synonyms: Cd30L, CD153, CD30LG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21949
Homologene: 950
Clcn3
Name: chloride channel, voltage-sensitive 3
Synonyms: Clc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12725
HGNC: HGNC:2021
Homologene: 20435
Gm4884
Name: predicted gene 4884
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233164
Kcnn3
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonyms: small conductance calcium-activated potassium channel 3, SK3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 140493
HGNC: HGNC:6292
Homologene: 20516
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 192188
Homologene: 23022
Vmn2r77
Name: vomeronasal 2, receptor 77
Synonyms: EG546983
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 546983
Homologene: 115466
Ermp1
Name: endoplasmic reticulum metallopeptidase 1
Synonyms: D19Ertd410e, D19Wsu12e, b2b2633Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226090
Homologene: 121891
Or8u10
Name: olfactory receptor family 8 subfamily U member 10
Synonyms: GA_x6K02T2Q125-47560740-47559775, MOR256-34P, MOR171-52, Olfr1037
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 259151
Homologene: 66572
Itgal
Name: integrin alpha L
Synonyms: LFA-1, Cd11a, Ly-21, Ly-15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16408
HGNC: HGNC:6148
Homologene: 1666
Tmem147
Name: transmembrane protein 147
Synonyms: 2010004E11Rik, 5033425B17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 69804
Homologene: 12330
Myocd
Name: myocardin
Synonyms: Srfcp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 214384
Homologene: 17043
Ly6g2
Name: lymphocyte antigen 6 complex, locus G2
Synonyms: BC025446
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223631
Slc4a10
Name: solute carrier family 4, sodium bicarbonate cotransporter-like, member 10
Synonyms: NCBE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94229
Homologene: 23340
P2ry14
Name: purinergic receptor P2Y, G-protein coupled, 14
Synonyms: A330108O13Rik, P2Y14, Gpr105
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 140795
Homologene: 15769
Ubxn8
Name: UBX domain protein 8
Synonyms: Rep8h, Rep-8, D0H8S2298E, Ubxd6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 108159
Homologene: 4149
Ift140
Name: intraflagellar transport 140
Synonyms: Wdtc2, Tce5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106633
Homologene: 40979
Fes
Name: feline sarcoma oncogene
Synonyms: c-fes
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14159
HGNC: HGNC:3657
Homologene: 37563
Cyp26b1
Name: cytochrome P450, family 26, subfamily b, polypeptide 1
Synonyms: P450RAI-2, retinoic acid B1, CP26
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232174
Homologene: 23179
Rab34
Name: RAB34, member RAS oncogene family
Synonyms: Rah1, Narr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19376
Homologene: 12908
Tbc1d4
Name: TBC1 domain family, member 4
Synonyms: 5930406J04Rik, AS160
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 210789
Homologene: 45451
Foxn1
Name: forkhead box N1
Synonyms: whn, Hfh11, D11Bhm185e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15218
Homologene: 2664
Lrrc8e
Name: leucine rich repeat containing 8 family, member E
Synonyms: C87354, 1810049O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72267
Homologene: 11817
Nek4
Name: NIMA (never in mitosis gene a)-related expressed kinase 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 23955
VEGA: 14
Homologene: 2376
Ipo4
Name: importin 4
Synonyms: 8430408O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 75751
Homologene: 5835
Nlrp5
Name: NLR family, pyrin domain containing 5
Synonyms: Op1, Mater, Nalp5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 23968
Homologene: 65105
Vmn2r8
Name: vomeronasal 2, receptor 8
Synonyms: EG627479
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 627479
Homologene: 129606
Steap4
Name: STEAP family member 4
Synonyms: Tiarp, Tnfaip9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 117167
Homologene: 36422
Arhgap22
Name: Rho GTPase activating protein 22
Synonyms: RHOGAP2, B230341L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239027
Homologene: 23292
Prb1c
Name: proline-rich protein BstNI subfamily 1C
Synonyms: Gm8882
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 667929
Pdc
Name: phosducin
Synonyms: Pdc, Rpr-1, Rpr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20028
HGNC: HGNC:8759
Homologene: 1950
Apol6
Name: apolipoprotein L 6
Synonyms: 2310076O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 71939
Homologene: 49940
Elmo1
Name: engulfment and cell motility 1
Synonyms: CED-12, C230095H21Rik, 6330578D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 140580
Homologene: 56685
Zfp715
Name: zinc finger protein 715
Synonyms: 2610041B18Rik, mszf15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 69930
Homologene: 74591
Zer1
Name: zyg-11 related, cell cycle regulator
Synonyms: C230075L19Rik, Zyg11bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227693
Homologene: 4621
Or13p5
Name: olfactory receptor family 13 subfamily P member 5
Synonyms: GA_x6K02T2QD9B-18815145-18814198, MOR258-2, Olfr1339
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 258851
Homologene: 27280
Rftn2
Name: raftlin family member 2
Synonyms: 2700010E02Rik, 3222401M22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74013
Homologene: 16954
4930433I11Rik
Name: RIKEN cDNA 4930433I11 gene
Synonyms: LOC243944
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243944
Homologene: 77912
Oxct2b
Name: 3-oxoacid CoA transferase 2B
Synonyms: Scot-t2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 353371
Homologene: 137359
Fem1al
Name: fem-1 homolog A like
Synonyms: 4931440F15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216622
Usp49
Name: ubiquitin specific peptidase 49
Synonyms: C330046L10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224836
Homologene: 10235
Vegfc
Name: vascular endothelial growth factor C
Synonyms: VEGF-C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 22341
Homologene: 3962
Tacc3
Name: transforming, acidic coiled-coil containing protein 3
Synonyms: Arnt interacting protein, Aint
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 21335
Homologene: 81618
Rad9a
Name: RAD9 checkpoint clamp component A
Synonyms: Rad9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 19367
VEGA: 19
HGNC: HGNC:9827
Homologene: 32118
Nras
Name: neuroblastoma ras oncogene
Synonyms: N-ras
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18176
HGNC: HGNC:7989
Homologene: 55661
Trim56
Name: tripartite motif-containing 56
Synonyms: LOC384309, RNF109, A130009K11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 384309
Homologene: 12812
Pdlim2
Name: PDZ and LIM domain 2
Synonyms: mystique, SLIM, 4732462F18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 213019
Homologene: 11006
Or6c75
Name: olfactory receptor family 6 subfamily C member 75
Synonyms: GA_x6K02T2PULF-11179777-11180721, MOR112-1, Olfr790
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258935
Homologene: 74101
R3hdm4
Name: R3H domain containing 4
Synonyms: C030046I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 109284
VEGA: 10
Homologene: 16343
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 546165
VEGA: 9
Setbp1
Name: SET binding protein 1
Synonyms: Seb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 240427
Homologene: 9192
Slc52a2
Name: solute carrier protein 52, member 2
Synonyms: 2010003P03Rik, GPCR42, PAR2, D15Ertd747e, Gpr172b, Rfvt2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 52710
VEGA: 15
Homologene: 56994
Zfp995
Name: zinc finger protein 995
Synonyms: 2210404O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 70081
Homologene: 133253
Taf10
Name: TATA-box binding protein associated factor 10
Synonyms: TAFII30, Taf2h, 30kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 24075
Homologene: 86923
Rtkn2
Name: rhotekin 2
Synonyms: B130039D23Rik, RTKN2, Mbf, Plekhk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 170799
Homologene: 17065
Rpp14
Name: ribonuclease P 14 subunit
Synonyms: 2610511E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67053
Homologene: 5113
Gm8444
Name: predicted gene 8444
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 667073
VEGA: 15
Bfar
Name: bifunctional apoptosis regulator
Synonyms: RNF47
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 67118
Homologene: 9563
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,223,858 bp
  • G to A, chromosome 1 at 55,204,299 bp
  • A to T, chromosome 1 at 57,943,111 bp
  • A to T, chromosome 1 at 59,859,304 bp
  • T to C, chromosome 1 at 150,333,245 bp
  • C to T, chromosome 2 at 30,108,246 bp
  • A to G, chromosome 2 at 62,228,574 bp
  • A to G, chromosome 2 at 73,097,194 bp
  • A to G, chromosome 2 at 86,085,291 bp
  • T to G, chromosome 2 at 153,711,781 bp
  • A to G, chromosome 2 at 168,184,500 bp
  • T to C, chromosome 3 at 59,115,131 bp
  • C to T, chromosome 3 at 89,564,952 bp
  • T to C, chromosome 3 at 103,064,103 bp
  • A to G, chromosome 4 at 63,837,086 bp
  • C to A, chromosome 4 at 118,734,632 bp
  • A to G, chromosome 4 at 123,117,585 bp
  • A to C, chromosome 5 at 7,976,520 bp
  • T to C, chromosome 5 at 33,663,912 bp
  • A to G, chromosome 5 at 76,624,637 bp
  • T to A, chromosome 5 at 101,875,931 bp
  • T to A, chromosome 5 at 108,803,176 bp
  • T to C, chromosome 5 at 118,228,882 bp
  • T to C, chromosome 5 at 137,112,520 bp
  • A to G, chromosome 6 at 84,584,330 bp
  • A to G, chromosome 6 at 115,935,423 bp
  • G to A, chromosome 6 at 132,361,590 bp
  • A to G, chromosome 7 at 16,157,387 bp
  • A to T, chromosome 7 at 19,634,211 bp
  • TCC to TC, chromosome 7 at 23,433,605 bp
  • A to G, chromosome 7 at 30,727,796 bp
  • A to T, chromosome 7 at 38,263,269 bp
  • A to T, chromosome 7 at 40,993,579 bp
  • A to T, chromosome 7 at 41,043,912 bp
  • A to T, chromosome 7 at 43,298,437 bp
  • A to T, chromosome 7 at 80,383,109 bp
  • A to G, chromosome 7 at 86,801,746 bp
  • T to C, chromosome 7 at 105,743,231 bp
  • A to T, chromosome 7 at 110,364,549 bp
  • G to A, chromosome 7 at 127,300,939 bp
  • A to G, chromosome 7 at 133,644,066 bp
  • A to T, chromosome 8 at 4,235,337 bp
  • A to G, chromosome 8 at 33,641,901 bp
  • A to T, chromosome 8 at 47,858,779 bp
  • A to C, chromosome 8 at 54,186,043 bp
  • A to G, chromosome 8 at 60,922,788 bp
  • A to T, chromosome 9 at 37,423,907 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • T to C, chromosome 10 at 67,997,620 bp
  • A to G, chromosome 10 at 79,912,073 bp
  • A to T, chromosome 10 at 86,947,307 bp
  • A to G, chromosome 10 at 121,416,254 bp
  • G to A, chromosome 10 at 129,501,150 bp
  • C to A, chromosome 11 at 20,223,172 bp
  • C to T, chromosome 11 at 29,823,567 bp
  • T to G, chromosome 11 at 36,864,684 bp
  • G to T, chromosome 11 at 65,196,377 bp
  • A to C, chromosome 11 at 78,189,674 bp
  • A to T, chromosome 11 at 78,359,066 bp
  • C to T, chromosome 13 at 3,888,993 bp
  • A to G, chromosome 13 at 11,660,113 bp
  • T to C, chromosome 13 at 20,185,455 bp
  • T to A, chromosome 14 at 8,083,705 bp
  • G to A, chromosome 14 at 30,974,345 bp
  • A to G, chromosome 14 at 31,050,142 bp
  • A to G, chromosome 14 at 33,343,307 bp
  • A to G, chromosome 14 at 55,635,020 bp
  • C to T, chromosome 14 at 70,164,779 bp
  • C to T, chromosome 14 at 101,608,019 bp
  • G to A, chromosome 15 at 45,114,156 bp
  • T to A, chromosome 15 at 75,217,837 bp
  • T to C, chromosome 15 at 76,345,221 bp
  • A to G, chromosome 15 at 76,539,591 bp
  • T to A, chromosome 15 at 77,047,108 bp
  • C to G, chromosome 15 at 78,888,170 bp
  • T to C, chromosome 15 at 81,843,380 bp
  • T to C, chromosome 15 at 89,573,974 bp
  • G to T, chromosome 16 at 4,676,922 bp
  • A to G, chromosome 16 at 13,698,894 bp
  • G to A, chromosome 17 at 21,879,979 bp
  • T to G, chromosome 17 at 25,035,745 bp
  • T to C, chromosome 17 at 32,122,745 bp
  • A to G, chromosome 17 at 47,672,226 bp
  • G to A, chromosome 18 at 78,857,236 bp
  • A to G, chromosome 19 at 4,197,502 bp
  • A to G, chromosome 19 at 29,628,679 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1167 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039240-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.