Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1167Btlr/Mmmh
Stock Number:
039240-MU
Citation ID:
RRID:MMRRC_039240-MU
Other Names:
R1167 (G1), C57BL/6J-MtgxR1167Btlr
Major Collection:

Strain Information

Sbf2
Name: SET binding factor 2
Synonyms: SBF2, 4833411B01Rik, mMTMH1, B430219L04Rik, Mtmr13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Net1
Name: neuroepithelial cell transforming gene 1
Synonyms: mNET1, Net1 homolog, 9530071N24Rik, 0610025H04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56349
VEGA: 13
Homologene: 4283
Rab1a
Name: RAB1A, member RAS oncogene family
Synonyms: ras-related YPT1 protein, Ypt1, Rab-1, Gtbp, Rab1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19324
HGNC: HGNC:9758
Homologene: 36154
Clptm1
Name: cleft lip and palate associated transmembrane protein 1
Synonyms: N14, HS9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56457
HGNC: HGNC:2087
Homologene: 37464
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,223,858 bp
  • G to A, chromosome 1 at 55,204,299 bp
  • A to T, chromosome 1 at 57,943,111 bp
  • A to T, chromosome 1 at 59,859,304 bp
  • T to C, chromosome 1 at 150,333,245 bp
  • C to T, chromosome 2 at 30,108,246 bp
  • A to G, chromosome 2 at 62,228,574 bp
  • A to G, chromosome 2 at 73,097,194 bp
  • A to G, chromosome 2 at 86,085,291 bp
  • T to G, chromosome 2 at 153,711,781 bp
  • A to G, chromosome 2 at 168,184,500 bp
  • T to C, chromosome 3 at 59,115,131 bp
  • C to T, chromosome 3 at 89,564,952 bp
  • T to C, chromosome 3 at 103,064,103 bp
  • A to G, chromosome 4 at 63,837,086 bp
  • C to A, chromosome 4 at 118,734,632 bp
  • A to G, chromosome 4 at 123,117,585 bp
  • A to C, chromosome 5 at 7,976,520 bp
  • T to C, chromosome 5 at 33,663,912 bp
  • A to G, chromosome 5 at 76,624,637 bp
  • T to A, chromosome 5 at 101,875,931 bp
  • T to A, chromosome 5 at 108,803,176 bp
  • T to C, chromosome 5 at 118,228,882 bp
  • T to C, chromosome 5 at 137,112,520 bp
  • A to G, chromosome 6 at 84,584,330 bp
  • A to G, chromosome 6 at 115,935,423 bp
  • G to A, chromosome 6 at 132,361,590 bp
  • A to G, chromosome 7 at 16,157,387 bp
  • A to T, chromosome 7 at 19,634,211 bp
  • TCC to TC, chromosome 7 at 23,433,605 bp
  • A to G, chromosome 7 at 30,727,796 bp
  • A to T, chromosome 7 at 38,263,269 bp
  • A to T, chromosome 7 at 40,993,579 bp
  • A to T, chromosome 7 at 41,043,912 bp
  • A to T, chromosome 7 at 43,298,437 bp
  • A to T, chromosome 7 at 80,383,109 bp
  • A to G, chromosome 7 at 86,801,746 bp
  • T to C, chromosome 7 at 105,743,231 bp
  • A to T, chromosome 7 at 110,364,549 bp
  • G to A, chromosome 7 at 127,300,939 bp
  • A to G, chromosome 7 at 133,644,066 bp
  • A to T, chromosome 8 at 4,235,337 bp
  • A to G, chromosome 8 at 33,641,901 bp
  • A to T, chromosome 8 at 47,858,779 bp
  • A to C, chromosome 8 at 54,186,043 bp
  • A to G, chromosome 8 at 60,922,788 bp
  • A to T, chromosome 9 at 37,423,907 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • T to C, chromosome 10 at 67,997,620 bp
  • A to G, chromosome 10 at 79,912,073 bp
  • A to T, chromosome 10 at 86,947,307 bp
  • A to G, chromosome 10 at 121,416,254 bp
  • G to A, chromosome 10 at 129,501,150 bp
  • C to A, chromosome 11 at 20,223,172 bp
  • C to T, chromosome 11 at 29,823,567 bp
  • T to G, chromosome 11 at 36,864,684 bp
  • G to T, chromosome 11 at 65,196,377 bp
  • A to C, chromosome 11 at 78,189,674 bp
  • A to T, chromosome 11 at 78,359,066 bp
  • C to T, chromosome 13 at 3,888,993 bp
  • A to G, chromosome 13 at 11,660,113 bp
  • T to C, chromosome 13 at 20,185,455 bp
  • T to A, chromosome 14 at 8,083,705 bp
  • G to A, chromosome 14 at 30,974,345 bp
  • A to G, chromosome 14 at 31,050,142 bp
  • A to G, chromosome 14 at 33,343,307 bp
  • A to G, chromosome 14 at 55,635,020 bp
  • C to T, chromosome 14 at 70,164,779 bp
  • C to T, chromosome 14 at 101,608,019 bp
  • G to A, chromosome 15 at 45,114,156 bp
  • T to A, chromosome 15 at 75,217,837 bp
  • T to C, chromosome 15 at 76,345,221 bp
  • A to G, chromosome 15 at 76,539,591 bp
  • T to A, chromosome 15 at 77,047,108 bp
  • C to G, chromosome 15 at 78,888,170 bp
  • T to C, chromosome 15 at 81,843,380 bp
  • T to C, chromosome 15 at 89,573,974 bp
  • G to T, chromosome 16 at 4,676,922 bp
  • A to G, chromosome 16 at 13,698,894 bp
  • G to A, chromosome 17 at 21,879,979 bp
  • T to G, chromosome 17 at 25,035,745 bp
  • T to C, chromosome 17 at 32,122,745 bp
  • A to G, chromosome 17 at 47,672,226 bp
  • G to A, chromosome 18 at 78,857,236 bp
  • A to G, chromosome 19 at 4,197,502 bp
  • A to G, chromosome 19 at 29,628,679 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1167 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039240-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.