Strain Name:
Stock Number:
Citation ID:
Other Names:
R1275 (G1), C57BL/6J-MtgxR1275Btlr
Major Collection:

Gene Information

Name: MINDY lysine 48 deubiquitinase 3
Synonyms: 1810041E18Rik, 5830410F13Rik, 2310047O13Rik, Fam188a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66960
Homologene: 11478
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 77683
Homologene: 11698
Name: zinc finger protein 930
Synonyms: zinc finger protein, D10627
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234358
Name: DEAD box helicase 46
Synonyms: 2200005K02Rik, 8430438J23Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 212880
VEGA: 13
Homologene: 5430
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13424
Homologene: 1053
Name: oxysterol binding protein-like 11
Synonyms: ORP-11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 106326
Homologene: 23385
Name: TBC1 domain family, member 1
Synonyms: 1110062G02Rik, Nob1, Nobq1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 57915
Homologene: 56856
Name: GDNF family receptor alpha like
Synonyms: GRAL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 404194
Homologene: 45748
Name: INO80 complex subunit
Synonyms: 2310079N15Rik, INO80, 4632409L19Rik, Inoc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68142
Homologene: 75070
Name: shieldin complex subunit 1
Synonyms: 1110034G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 73747
Homologene: 51865
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 269700
Homologene: 28297
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 22249
Homologene: 31376
Name: coronin, actin binding protein 1A
Synonyms: p57, coronin 1, Clabp, Lmb3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12721
Homologene: 6545
Name: protein phosphatase 2, regulatory subunit A, beta
Synonyms: 2410091N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 73699
Homologene: 70244
Name: myosin XVB
Synonyms: LOC217328, LOC380737, E330039G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217328
Name: predicted gene 281
Synonyms: LOC238939
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 238939
Homologene: 141164
Name: EF-hand calcium binding domain 14
Synonyms: 4732418C07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230648
Homologene: 8858
Name: RIKEN cDNA 1700123L14 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 78482
Name: vomeronasal 1 receptor 234
Synonyms: V1rf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 171232
Name: calsyntenin 2
Synonyms: CS2, 2900042C18Rik, Cst-2, CSTN2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 64085
Homologene: 49698
Name: Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
Synonyms: 2400009B11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 66985
Homologene: 2595
Name: fos-like antigen 2
Synonyms: Fra-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14284
Homologene: 3845
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 2 at 12,396,173 bp
  • A to G, chromosome 2 at 24,886,995 bp
  • T to C, chromosome 2 at 119,427,055 bp
  • T to C, chromosome 2 at 132,692,095 bp
  • A to G, chromosome 4 at 43,235,366 bp
  • T to G, chromosome 4 at 115,756,473 bp
  • C to T, chromosome 5 at 32,150,454 bp
  • T to C, chromosome 5 at 64,271,083 bp
  • C to T, chromosome 5 at 121,319,962 bp
  • T to C, chromosome 6 at 96,165,118 bp
  • C to T, chromosome 7 at 126,700,583 bp
  • T to A, chromosome 7 at 141,217,147 bp
  • A to G, chromosome 8 at 69,227,979 bp
  • C to T, chromosome 9 at 50,858,848 bp
  • A to G, chromosome 9 at 76,197,032 bp
  • C to T, chromosome 9 at 97,457,430 bp
  • CGGAGGAGGAGGAGGAGGAG to CGGAGGAGGAGGAGGAG, chromosome 11 at 115,883,492 bp
  • G to A, chromosome 12 at 110,636,509 bp
  • T to C, chromosome 13 at 55,659,011 bp
  • T to C, chromosome 14 at 13,896,949 bp
  • T to A, chromosome 16 at 33,185,850 bp
  • CTT to CTTT, chromosome 17 at 21,229,251 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1275 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039341-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.