Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1275Btlr/Mmmh
Stock Number:
039341-MU
Citation ID:
RRID:MMRRC_039341-MU
Other Names:
R1275 (G1), C57BL/6J-MtgxR1275Btlr
Major Collection:

Strain Information

Mindy3
Name: MINDY lysine 48 deubiquitinase 3
Synonyms: 1810041E18Rik, 5830410F13Rik, 2310047O13Rik, Fam188a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66960
Homologene: 11478
Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77683
Homologene: 11698
Zfp930
Name: zinc finger protein 930
Synonyms: zinc finger protein, D10627
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234358
Ddx46
Name: DEAD box helicase 46
Synonyms: 2200005K02Rik, 8430438J23Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212880
VEGA: 13
Homologene: 5430
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Osbpl11
Name: oxysterol binding protein-like 11
Synonyms: ORP-11
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106326
Homologene: 23385
Tbc1d1
Name: TBC1 domain family, member 1
Synonyms: 1110062G02Rik, Nob1, Nobq1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57915
Homologene: 56856
Gfral
Name: GDNF family receptor alpha like
Synonyms: GRAL
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 404194
Homologene: 45748
Ino80
Name: INO80 complex subunit
Synonyms: 2310079N15Rik, INO80, 4632409L19Rik, Inoc1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68142
Homologene: 75070
Shld1
Name: shieldin complex subunit 1
Synonyms: 1110034G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 73747
Homologene: 51865
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Coro1a
Name: coronin, actin binding protein 1A
Synonyms: p57, coronin 1, Clabp, Lmb3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12721
HGNC: HGNC:2252
Homologene: 6545
Ppp2r1b
Name: protein phosphatase 2, regulatory subunit A, beta
Synonyms: 2410091N08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73699
HGNC: HGNC:9303
Homologene: 70244
Myo15b
Name: myosin XVB
Synonyms: LOC217328, LOC380737, E330039G21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217328
Cdhr18
Name: cadherin related family member 18
Synonyms: LOC238939, Gm281
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 238939
Homologene: 141164
Efcab14
Name: EF-hand calcium binding domain 14
Synonyms: 4732418C07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230648
Homologene: 8858
Nup50l
Name: nucleoporin 50 like
Synonyms: 1700123L14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78482
HGNC: HGNC:8065
Vmn1r234
Name: vomeronasal 1 receptor 234
Synonyms: V1rf1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171232
Clstn2
Name: calsyntenin 2
Synonyms: CS2, 2900042C18Rik, Cst-2, CSTN2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64085
Homologene: 49698
Rassf7
Name: Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
Synonyms: 2400009B11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66985
HGNC: HGNC:1166
Homologene: 2595
Fosl2
Name: fos-like antigen 2
Synonyms: Fra-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14284
HGNC: HGNC:3798
Homologene: 3845
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 2 at 12,396,173 bp
  • A to G, chromosome 2 at 24,886,995 bp
  • T to C, chromosome 2 at 119,427,055 bp
  • T to C, chromosome 2 at 132,692,095 bp
  • A to G, chromosome 4 at 43,235,366 bp
  • T to G, chromosome 4 at 115,756,473 bp
  • C to T, chromosome 5 at 32,150,454 bp
  • T to C, chromosome 5 at 64,271,083 bp
  • C to T, chromosome 5 at 121,319,962 bp
  • T to C, chromosome 6 at 96,165,118 bp
  • C to T, chromosome 7 at 126,700,583 bp
  • T to A, chromosome 7 at 141,217,147 bp
  • A to G, chromosome 8 at 69,227,979 bp
  • C to T, chromosome 9 at 50,858,848 bp
  • A to G, chromosome 9 at 76,197,032 bp
  • C to T, chromosome 9 at 97,457,430 bp
  • CGGAGGAGGAGGAGGAGGAG to CGGAGGAGGAGGAGGAG, chromosome 11 at 115,883,492 bp
  • G to A, chromosome 12 at 110,636,509 bp
  • T to C, chromosome 13 at 55,659,011 bp
  • T to C, chromosome 14 at 13,896,949 bp
  • T to A, chromosome 16 at 33,185,850 bp
  • CTT to CTTT, chromosome 17 at 21,229,251 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1275 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039341-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.