Strain Name:
C57BL/6J-MtgxR1327Btlr/Mmmh
Stock Number:
039393-MU
Citation ID:
RRID:MMRRC_039393-MU
Other Names:
R1327 (G1), C57BL/6J-MtgxR1327Btlr
Major Collection:

Strain Information

Slc6a6
Name: solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms: Taut
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21366
Homologene: 2291
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: Her4, ErbB4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Rnf111
Name: ring finger 111
Synonyms: Arkadia
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 93836
VEGA: 9
Homologene: 9741
Smad7
Name: SMAD family member 7
Synonyms: Madh7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17131
HGNC: HGNC:6773
Homologene: 4314
Acbd3
Name: acyl-Coenzyme A binding domain containing 3
Synonyms: 8430407O11Rik, D1Ertd10e, Pap7, Gocap1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170760
Homologene: 11227
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Fh1
Name: fumarate hydratase 1
Synonyms: fumarase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14194
HGNC: HGNC:3700
Homologene: 115
Zzef1
Name: zinc finger, ZZ-type with EF hand domain 1
Synonyms: 8430405D05Rik, C130099L13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195018
Homologene: 9027
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: enaptin165, SYNE-1, C130039F11Rik, A330049M09Rik, nesprin-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Zfp318
Name: zinc finger protein 318
Synonyms: 2610034E08Rik, TZF, D530032D06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57908
Homologene: 22808
Zftraf1
Name: zinc finger TRAF type containing 1
Synonyms: Cyhr1, 1110031M01Rik, Chrp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54151
Homologene: 32791
Fbxw11
Name: F-box and WD-40 domain protein 11
Synonyms: BTRC2, BTRCP2, 2310065A07Rik, Fbxw1b, HOS
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103583
Homologene: 76444
Vit
Name: vitrin
Synonyms: 1700052E02Rik, akhirin, AKH, 1700110E08Rik, 2810429K11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74199
VEGA: 17
Homologene: 24942
Zic5
Name: zinc finger protein of the cerebellum 5
Synonyms: Opr, odd-paired related, 1700049L20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 65100
Homologene: 11301
Epha5
Name: Eph receptor A5
Synonyms: Ehk1, bsk, Els1, Cek7, Rek7, Hek7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13839
HGNC: HGNC:3389
Homologene: 55824
Txndc11
Name: thioredoxin domain containing 11
Synonyms: 2810408E11Rik, EFP1, Txdc11, EF-hand binding protein 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106200
Homologene: 9301
Rin2
Name: Ras and Rab interactor 2
Synonyms: 2010003K16Rik, RASSF4, 4632403N06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74030
Homologene: 32430
Mrgprb1
Name: MAS-related GPR, member B1
Synonyms: MrgB1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233231
Homologene: 24986
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Ect2l
Name: epithelial cell transforming sequence 2 oncogene-like
Synonyms: C330021H03Rik, Gm10331
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100045792
Homologene: 46005
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: oxygen-regulated protein 1, Dcdc3, Rp1h, Orp1, mG145
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Pappa
Name: pregnancy-associated plasma protein A
Synonyms: PAPP-A, IGFBP-4ase, 8430414N03Rik, PAG1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18491
HGNC: HGNC:8602
Homologene: 31097
Synj1
Name: synaptojanin 1
Synonyms: A930006D20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 104015
Homologene: 48252
Arg1
Name: arginase, liver
Synonyms: PGIF, AI, Arg-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11846
VEGA: 10
HGNC: HGNC:663
Homologene: 29
Gm7052
Name: predicted gene 7052
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 631010
Ms4a13
Name: membrane-spanning 4-domains, subfamily A, member 13
Synonyms: 1700060E18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73466
Homologene: 77851
Setbp1
Name: SET binding protein 1
Synonyms: Seb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240427
Homologene: 9192
Bsnd
Name: barttin CLCNK type accessory beta subunit
Synonyms: Bartter syndrome, infantile, with sensorineural deafness (Barttin)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140475
Homologene: 14291
Cxcl9
Name: C-X-C motif chemokine ligand 9
Synonyms: Scyb9, CMK, crg-10, Mig
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17329
HGNC: HGNC:7098
Homologene: 137210
Nipa2
Name: non imprinted in Prader-Willi/Angelman syndrome 2 homolog (human)
Synonyms: 2600017P10Rik, 3830408P04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 93790
Homologene: 11368
Star
Name: steroidogenic acute regulatory protein
Synonyms: D8Ertd419e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20845
Homologene: 297
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 4,347,970 bp
  • TCACACACACACACACACACACACACACA to TCACACACACACACACACACACACACACACACA, chromosome 1 at 68,331,177 bp
  • A to G, chromosome 1 at 175,609,744 bp
  • T to C, chromosome 1 at 180,733,183 bp
  • C to T, chromosome 2 at 145,860,446 bp
  • A to T, chromosome 2 at 150,266,150 bp
  • T to A, chromosome 4 at 65,351,603 bp
  • C to T, chromosome 4 at 106,486,612 bp
  • C to A, chromosome 5 at 84,106,785 bp
  • A to G, chromosome 5 at 92,326,850 bp
  • T to C, chromosome 5 at 137,465,911 bp
  • A to G, chromosome 6 at 91,726,035 bp
  • A to T, chromosome 7 at 48,447,429 bp
  • G to A, chromosome 7 at 55,944,508 bp
  • A to G, chromosome 8 at 25,809,837 bp
  • A to T, chromosome 9 at 70,453,816 bp
  • C to A, chromosome 10 at 5,048,925 bp
  • C to T, chromosome 10 at 18,165,542 bp
  • T to C, chromosome 10 at 24,920,804 bp
  • T to C, chromosome 11 at 32,711,859 bp
  • T to C, chromosome 11 at 72,893,414 bp
  • T to C, chromosome 14 at 50,853,099 bp
  • T to G, chromosome 14 at 122,459,779 bp
  • T to A, chromosome 15 at 76,649,176 bp
  • T to C, chromosome 16 at 11,116,814 bp
  • A to T, chromosome 16 at 90,946,855 bp
  • A to G, chromosome 17 at 22,039,581 bp
  • A to G, chromosome 17 at 46,413,263 bp
  • G to A, chromosome 17 at 78,625,200 bp
  • T to C, chromosome 18 at 75,375,945 bp
  • T to C, chromosome 18 at 78,783,358 bp
  • A to G, chromosome 19 at 7,431,011 bp
  • A to T, chromosome 19 at 11,183,887 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1327 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039393-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.