Strain Name:
C57BL/6J-MtgxR1412Btlr/Mmmh
Stock Number:
039468-MU
Citation ID:
RRID:MMRRC_039468-MU
Other Names:
R1412 (G1), C57BL/6J-MtgxR1412Btlr
Major Collection:

Strain Information

D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, 9930124L22Rik, Fnbp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Vps35l
Name: VPS35 endosomal protein sorting factor like
Synonyms: 9030624J02Rik, Vsp35l
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71517
Homologene: 10659
Zfhx3
Name: zinc finger homeobox 3
Synonyms: WBP9, A230102L03Rik, Atbf1, Sci
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11906
HGNC: HGNC:777
Homologene: 21366
Arl6ip1
Name: ADP-ribosylation factor-like 6 interacting protein 1
Synonyms: AIP-6, ARMER
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54208
HGNC: HGNC:697
Homologene: 41008
Hat1
Name: histone aminotransferase 1
Synonyms: 2410071B14Rik, KAT1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107435
HGNC: HGNC:4821
Homologene: 2701
Focad
Name: focadhesin
Synonyms: BC057079
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230393
Homologene: 9842
Pikfyve
Name: phosphoinositide kinase, FYVE type zinc finger containing
Synonyms: 5230400C17Rik, Pip5k3, PipkIII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18711
Homologene: 32115
Gabbr1
Name: gamma-aminobutyric acid type B receptor subunit 1
Synonyms: GABAbR1, GABAB1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54393
HGNC: HGNC:4070
Homologene: 1132
C1qtnf2
Name: C1q and tumor necrosis factor related protein 2
Synonyms: 1810033K05Rik, CTRP2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69183
Homologene: 12899
Socs2
Name: suppressor of cytokine signaling 2
Synonyms: SOCS-2, cytokine-inducible SH2 protein 2, STAT-induced STAT inhibitor 2, SSI-2, CIS2, JAB, Cish2, D130043N08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216233
Homologene: 2880
Akap7
Name: A kinase anchor protein 7
Synonyms: Akap18, AKAP15
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432442
HGNC: HGNC:377
Homologene: 49463
Cdc123
Name: cell division cycle 123
Synonyms: G431001I09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98828
Homologene: 4394
Rasgrp3
Name: RAS, guanyl releasing protein 3
Synonyms: LOC240168
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240168
VEGA: 17
Homologene: 15019
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Chdh
Name: choline dehydrogenase
Synonyms: D630034H06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218865
Homologene: 41261
Vwa3a
Name: von Willebrand factor A domain containing 3A
Synonyms: E030013G06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233813
Homologene: 18607
Abca15
Name: ATP-binding cassette, sub-family A member 15
Synonyms: 4930500I12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320631
Homologene: 87255
Atp1a4
Name: ATPase, Na+/K+ transporting, alpha 4 polypeptide
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27222
Homologene: 113769
Adamts9
Name: ADAM metallopeptidase with thrombospondin type 1 motif 9
Synonyms: 1810011L16Rik, E030027K14Rik, 8430403M15Rik, Mhdaund4, Gsfund3, UND3, Mhdaund3, UND4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101401
Homologene: 18821
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 4932416F07Rik, 1300010F03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Parp10
Name: poly (ADP-ribose) polymerase family, member 10
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 671535
Homologene: 53133
Tas2r135
Name: taste receptor, type 2, member 135
Synonyms: mt2r38, Tas2r35
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387512
Homologene: 52230
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Agbl2
Name: ATP/GTP binding protein-like 2
Synonyms: A430081C19Rik, Ccp2, Ccp2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271813
Homologene: 11715
Raly
Name: hnRNP-associated with lethal yellow
Synonyms: Merc
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19383
Homologene: 7216
Itga2b
Name: integrin alpha 2b
Synonyms: platelet glycoprotein IIb, GpIIb, alphaIIb, CD41, GP IIb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16399
HGNC: HGNC:6138
Homologene: 37304
Pbld2
Name: phenazine biosynthesis-like protein domain containing 2
Synonyms: 3110049J23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67307
B3galt4
Name: UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Synonyms: Gal-T2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54218
HGNC: HGNC:919
Homologene: 2805
Hs3st5
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 5
Synonyms: LOC382362, D930005L05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319415
Homologene: 17796
Vmn1r234
Name: vomeronasal 1 receptor 234
Synonyms: V1rf1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171232
Pdlim2
Name: PDZ and LIM domain 2
Synonyms: mystique, SLIM, 4732462F18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 213019
Homologene: 11006
Pla2g12b
Name: phospholipase A2, group XIIB
Synonyms: 2010002E04Rik, Pla2g13, hlb218
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69836
Homologene: 11356
1810009A15Rik
Name: RIKEN cDNA 1810009A15 gene
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66276
Homologene: 84408
Or7d11
Name: olfactory receptor family 7 subfamily D member 11
Synonyms: GA_x6K02T2PVTD-13795933-13794938, MOR143-2, Olfr867
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257898
HGNC: HGNC:8380
Homologene: 128152
Or52e8b
Name: olfactory receptor family 52 subfamily E member 8B
Synonyms: GA_x6K02T2PBJ9-7653782-7652841, MOR32-9P, Olfr675
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258147
Homologene: 133595
C1qtnf12
Name: C1q and tumor necrosis factor related 12
Synonyms: 1110035L05Rik, C1qdc2, alipolin, Fam132a, adipolin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67389
Homologene: 12123
Tex19.2
Name: testis expressed gene 19.2
Synonyms: 4921530G04Rik, Tex19.2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70956
Homologene: 132323
AC163723.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 65,202,830 bp
  • T to C, chromosome 1 at 131,300,413 bp
  • C to T, chromosome 1 at 172,232,009 bp
  • A to T, chromosome 2 at 5,803,965 bp
  • G to T, chromosome 2 at 71,420,617 bp
  • A to G, chromosome 2 at 90,788,954 bp
  • A to G, chromosome 2 at 154,857,395 bp
  • T to C, chromosome 3 at 59,327,775 bp
  • T to C, chromosome 4 at 88,278,261 bp
  • T to C, chromosome 4 at 155,962,733 bp
  • A to G, chromosome 6 at 38,195,760 bp
  • A to G, chromosome 6 at 42,405,834 bp
  • T to C, chromosome 6 at 92,796,433 bp
  • A to G, chromosome 7 at 105,024,195 bp
  • A to G, chromosome 7 at 118,120,368 bp
  • A to T, chromosome 7 at 118,809,971 bp
  • C to T, chromosome 7 at 120,345,323 bp
  • C to T, chromosome 7 at 120,780,154 bp
  • A to G, chromosome 8 at 108,914,567 bp
  • C to G, chromosome 9 at 20,055,415 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • A to T, chromosome 10 at 25,289,597 bp
  • A to T, chromosome 10 at 36,832,676 bp
  • G to A, chromosome 10 at 59,403,982 bp
  • A to G, chromosome 10 at 63,047,522 bp
  • T to C, chromosome 10 at 95,414,918 bp
  • A to G, chromosome 11 at 43,491,132 bp
  • A to T, chromosome 11 at 102,457,005 bp
  • A to G, chromosome 11 at 121,116,935 bp
  • C to T, chromosome 13 at 81,095,450 bp
  • G to A, chromosome 14 at 30,034,723 bp
  • A to T, chromosome 14 at 70,174,324 bp
  • C to T, chromosome 14 at 78,908,230 bp
  • A to G, chromosome 15 at 76,243,084 bp
  • G to C, chromosome 16 at 5,007,785 bp
  • T to A, chromosome 17 at 21,229,250 bp
  • G to A, chromosome 17 at 33,950,839 bp
  • T to C, chromosome 17 at 37,054,913 bp
  • G to T, chromosome 17 at 75,509,827 bp
  • T to C, chromosome 19 at 8,889,995 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1412 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039468-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.