Strain Name:
Stock Number:
Citation ID:
Other Names:
R1412 (G1), C57BL/6J-MtgxR1412Btlr
Major Collection:

Gene Information

Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330286
Homologene: 19782
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71973
Homologene: 49895
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, 9930124L22Rik, Fnbp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14270
Homologene: 52683
Name: VPS35 endosomal protein sorting factor like
Synonyms: 9030624J02Rik, Vsp35l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71517
Homologene: 10659
Name: zinc finger homeobox 3
Synonyms: WBP9, A230102L03Rik, Atbf1, Sci
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11906
Homologene: 21366
Name: ADP-ribosylation factor-like 6 interacting protein 1
Synonyms: AIP-6, ARMER
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 54208
Homologene: 41008
Name: histone aminotransferase 1
Synonyms: 2410071B14Rik, KAT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 107435
Homologene: 2701
Name: focadhesin
Synonyms: BC057079
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230393
Homologene: 9842
Name: phosphoinositide kinase, FYVE type zinc finger containing
Synonyms: 5230400C17Rik, Pip5k3, PipkIII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18711
Homologene: 32115
Name: gamma-aminobutyric acid (GABA) B receptor, 1
Synonyms: GABAbR1, GABAB1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 54393
Homologene: 1132
Name: C1q and tumor necrosis factor related protein 2
Synonyms: 1810033K05Rik, CTRP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69183
Homologene: 12899
Name: suppressor of cytokine signaling 2
Synonyms: SOCS-2, cytokine-inducible SH2 protein 2, STAT-induced STAT inhibitor 2, SSI-2, CIS2, JAB, Cish2, D130043N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216233
Homologene: 2880
Name: A kinase (PRKA) anchor protein 7
Synonyms: Akap18, AKAP15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 432442
Homologene: 49463
Name: cell division cycle 123
Synonyms: G431001I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 98828
Homologene: 4394
Name: RAS, guanyl releasing protein 3
Synonyms: LOC240168
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240168
VEGA: 17
Homologene: 15019
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 110789
Homologene: 19815
Name: choline dehydrogenase
Synonyms: D630034H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218865
Homologene: 41261
Name: von Willebrand factor A domain containing 3A
Synonyms: E030013G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233813
Homologene: 18607
Name: ATP-binding cassette, sub-family A (ABC1), member 15
Synonyms: 4930500I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 320631
Homologene: 87255
Name: ATPase, Na+/K+ transporting, alpha 4 polypeptide
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 27222
Homologene: 113769
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9
Synonyms: 1810011L16Rik, E030027K14Rik, 8430403M15Rik, Mhdaund4, Gsfund3, UND3, Mhdaund3, UND4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 101401
Homologene: 18821
Name: von Willebrand factor A domain containing 8
Synonyms: 4932416F07Rik, 1300010F03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Name: poly (ADP-ribose) polymerase family, member 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 671535
Homologene: 53133
Name: taste receptor, type 2, member 135
Synonyms: mt2r38, Tas2r35
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387512
Homologene: 52230
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242050
Homologene: 18712
Name: ATP/GTP binding protein-like 2
Synonyms: A430081C19Rik, Ccp2, Ccp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 271813
Homologene: 11715
Name: hnRNP-associated with lethal yellow
Synonyms: Merc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19383
Homologene: 7216
Name: integrin alpha 2b
Synonyms: platelet glycoprotein IIb, GpIIb, alphaIIb, CD41, GP IIb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16399
Homologene: 37304
Name: phenazine biosynthesis-like protein domain containing 2
Synonyms: 3110049J23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67307
Name: UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Synonyms: Gal-T2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 54218
Homologene: 2805
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 5
Synonyms: LOC382362, D930005L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 319415
Homologene: 17796
Name: vomeronasal 1 receptor 234
Synonyms: V1rf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 171232
Name: PDZ and LIM domain 2
Synonyms: mystique, SLIM, 4732462F18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 213019
Homologene: 11006
Name: phospholipase A2, group XIIB
Synonyms: 2010002E04Rik, Pla2g13, hlb218
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 69836
Homologene: 11356
Name: RIKEN cDNA 1810009A15 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66276
Homologene: 84408
Name: olfactory receptor 867
Synonyms: GA_x6K02T2PVTD-13795933-13794938, MOR143-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 257898
Homologene: 128152
Name: olfactory receptor 675
Synonyms: GA_x6K02T2PBJ9-7653782-7652841, MOR32-9P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258147
Homologene: 133595
Name: C1q and tumor necrosis factor related 12
Synonyms: 1110035L05Rik, C1qdc2, alipolin, Fam132a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67389
Homologene: 12123
Name: testis expressed gene 19.2
Synonyms: 4921530G04Rik, Tex19.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70956
Homologene: 132323
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 65,202,830 bp
  • T to C, chromosome 1 at 131,300,413 bp
  • C to T, chromosome 1 at 172,232,009 bp
  • A to T, chromosome 2 at 5,803,965 bp
  • G to T, chromosome 2 at 71,420,617 bp
  • A to G, chromosome 2 at 90,788,954 bp
  • A to G, chromosome 2 at 154,857,395 bp
  • T to C, chromosome 3 at 59,327,775 bp
  • T to C, chromosome 4 at 88,278,261 bp
  • T to C, chromosome 4 at 155,962,733 bp
  • A to G, chromosome 6 at 38,195,760 bp
  • A to G, chromosome 6 at 42,405,834 bp
  • T to C, chromosome 6 at 92,796,433 bp
  • A to G, chromosome 7 at 105,024,195 bp
  • A to G, chromosome 7 at 118,120,368 bp
  • A to T, chromosome 7 at 118,809,971 bp
  • C to T, chromosome 7 at 120,345,323 bp
  • C to T, chromosome 7 at 120,780,154 bp
  • A to G, chromosome 8 at 108,914,567 bp
  • C to G, chromosome 9 at 20,055,415 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • A to T, chromosome 10 at 25,289,597 bp
  • A to T, chromosome 10 at 36,832,676 bp
  • G to A, chromosome 10 at 59,403,982 bp
  • A to G, chromosome 10 at 63,047,522 bp
  • T to C, chromosome 10 at 95,414,918 bp
  • A to G, chromosome 11 at 43,491,132 bp
  • A to T, chromosome 11 at 102,457,005 bp
  • A to G, chromosome 11 at 121,116,935 bp
  • C to T, chromosome 13 at 81,095,450 bp
  • G to A, chromosome 14 at 30,034,723 bp
  • A to T, chromosome 14 at 70,174,324 bp
  • C to T, chromosome 14 at 78,908,230 bp
  • A to G, chromosome 15 at 76,243,084 bp
  • G to C, chromosome 16 at 5,007,785 bp
  • T to A, chromosome 17 at 21,229,250 bp
  • G to A, chromosome 17 at 33,950,839 bp
  • T to C, chromosome 17 at 37,054,913 bp
  • G to T, chromosome 17 at 75,509,827 bp
  • T to C, chromosome 19 at 8,889,995 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1412 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039468-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.