Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1483Btlr/Mmmh
Stock Number:
039536-MU
Citation ID:
RRID:MMRRC_039536-MU
Other Names:
R1483 (G1), C57BL/6J-MtgxR1483Btlr
Major Collection:

Strain Information

H2-DMa
Name: histocompatibility 2, class II, locus DMa
Synonyms: H2-Ma, H-2Ma, H2-M alpha
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14998
HGNC: HGNC:4934
Homologene: 4464
Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Elf1
Name: E74 like ETS transcription factor 1
Synonyms: Elf-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13709
VEGA: 14
HGNC: HGNC:3316
Homologene: 7303
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Socs3
Name: suppressor of cytokine signaling 3
Synonyms: EF-10, SOCS-3, cytokine-inducible SH2 protein 3, CIS3, STAT-induced STAT inhibitor 3, SSI-3, E2a-Pbx1 target gene in fibroblasts 10, Cish3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12702
Homologene: 2941
Scrib
Name: scribbled planar cell polarity
Synonyms: Scrb1, Crc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105782
Homologene: 44228
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 9,872,293 bp
  • C to T, chromosome 1 at 34,252,998 bp
  • C to A, chromosome 1 at 58,447,726 bp
  • A to G, chromosome 1 at 74,349,391 bp
  • CGCTGCTGCTGCTGCTGCTGCTGCTGC to CGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 84,585,549 bp
  • G to T, chromosome 1 at 86,427,186 bp
  • T to A, chromosome 1 at 135,966,669 bp
  • T to G, chromosome 2 at 72,055,026 bp
  • T to A, chromosome 2 at 76,724,993 bp
  • A to T, chromosome 2 at 120,323,648 bp
  • A to T, chromosome 3 at 31,043,792 bp
  • G to A, chromosome 3 at 56,002,790 bp
  • G to A, chromosome 3 at 95,735,963 bp
  • T to C, chromosome 3 at 158,186,970 bp
  • T to A, chromosome 4 at 44,308,937 bp
  • T to A, chromosome 4 at 88,628,834 bp
  • C to T, chromosome 4 at 118,235,964 bp
  • T to A, chromosome 4 at 123,510,977 bp
  • T to C, chromosome 4 at 129,676,663 bp
  • A to G, chromosome 5 at 30,169,494 bp
  • T to C, chromosome 5 at 31,203,121 bp
  • C to T, chromosome 5 at 115,436,379 bp
  • T to A, chromosome 5 at 142,659,638 bp
  • T to C, chromosome 5 at 143,174,344 bp
  • G to T, chromosome 6 at 52,243,456 bp
  • A to G, chromosome 6 at 103,647,287 bp
  • A to G, chromosome 6 at 126,954,770 bp
  • T to G, chromosome 7 at 6,389,745 bp
  • A to G, chromosome 7 at 6,682,125 bp
  • T to G, chromosome 7 at 41,649,075 bp
  • T to A, chromosome 7 at 55,825,707 bp
  • T to C, chromosome 7 at 85,559,167 bp
  • T to G, chromosome 7 at 107,190,122 bp
  • C to T, chromosome 7 at 118,853,050 bp
  • T to A, chromosome 7 at 133,930,025 bp
  • T to C, chromosome 7 at 140,295,830 bp
  • C to T, chromosome 8 at 22,096,790 bp
  • A to G, chromosome 8 at 25,753,128 bp
  • C to T, chromosome 8 at 72,657,086 bp
  • G to A, chromosome 9 at 36,581,324 bp
  • A to G, chromosome 9 at 69,364,385 bp
  • A to T, chromosome 9 at 78,242,493 bp
  • A to T, chromosome 9 at 102,730,897 bp
  • A to T, chromosome 9 at 107,540,400 bp
  • G to T, chromosome 9 at 108,081,650 bp
  • A to C, chromosome 9 at 116,109,557 bp
  • A to G, chromosome 10 at 30,840,382 bp
  • A to T, chromosome 10 at 79,903,100 bp
  • A to G, chromosome 11 at 6,602,217 bp
  • A to G, chromosome 11 at 23,284,863 bp
  • A to G, chromosome 11 at 60,388,889 bp
  • T to C, chromosome 11 at 60,459,527 bp
  • A to C, chromosome 11 at 94,669,567 bp
  • A to G, chromosome 11 at 117,869,563 bp
  • A to T, chromosome 11 at 117,967,568 bp
  • G to A, chromosome 11 at 121,055,826 bp
  • C to T, chromosome 12 at 52,796,087 bp
  • A to T, chromosome 13 at 59,742,903 bp
  • T to A, chromosome 14 at 33,100,966 bp
  • T to A, chromosome 14 at 56,118,712 bp
  • C to T, chromosome 14 at 64,029,047 bp
  • T to A, chromosome 14 at 79,580,638 bp
  • T to C, chromosome 15 at 58,637,970 bp
  • A to G, chromosome 15 at 76,057,922 bp
  • A to G, chromosome 15 at 78,165,236 bp
  • T to A, chromosome 15 at 84,939,727 bp
  • T to A, chromosome 15 at 85,902,101 bp
  • T to A, chromosome 17 at 34,135,750 bp
  • A to T, chromosome 17 at 36,121,146 bp
  • T to A, chromosome 17 at 40,562,925 bp
  • T to A, chromosome 17 at 43,627,607 bp
  • A to T, chromosome 17 at 45,408,364 bp
  • A to T, chromosome 17 at 53,725,045 bp
  • C to T, chromosome 18 at 20,595,950 bp
  • T to A, chromosome 19 at 12,209,750 bp
  • G to A, chromosome 19 at 29,719,345 bp
  • A to G, chromosome 19 at 34,594,641 bp
  • A to T, chromosome 19 at 60,768,726 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1483 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039536-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.