Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1483Btlr/Mmmh
Stock Number:
039536-MU
Citation ID:
RRID:MMRRC_039536-MU
Other Names:
R1483 (G1), C57BL/6J-MtgxR1483Btlr
Major Collection:

Strain Information

H2-DMa
Name: histocompatibility 2, class II, locus DMa
Synonyms: H2-Ma, H-2Ma, H2-M alpha
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14998
HGNC: HGNC:4934
Homologene: 4464
Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Elf1
Name: E74 like ETS transcription factor 1
Synonyms: Elf-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13709
VEGA: 14
HGNC: HGNC:3316
Homologene: 7303
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Socs3
Name: suppressor of cytokine signaling 3
Synonyms: EF-10, SOCS-3, cytokine-inducible SH2 protein 3, CIS3, STAT-induced STAT inhibitor 3, SSI-3, E2a-Pbx1 target gene in fibroblasts 10, Cish3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12702
Homologene: 2941
Scrib
Name: scribbled planar cell polarity
Synonyms: Scrb1, Crc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105782
Homologene: 44228
Prkci
Name: protein kinase C, iota
Synonyms: Pkcl, Pkci, 2310021H13Rik, Prkcl, aPKClambda, PKClambda
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18759
HGNC: HGNC:9404
Homologene: 37667
Cdc5l
Name: cell division cycle 5-like
Synonyms: PCDC5RP, 1200002I02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71702
VEGA: 17
HGNC: HGNC:1743
Homologene: 13291
Xpo1
Name: exportin 1
Synonyms: Crm1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103573
Homologene: 2554
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: GCP5, B130010C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233276
Homologene: 14172
Eif3a
Name: eukaryotic translation initiation factor 3, subunit A
Synonyms: Csma, Eif3, A830012B05Rik, Eif3s10
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13669
VEGA: 19
HGNC: HGNC:3271
Homologene: 2779
Vps39
Name: VPS39 HOPS complex subunit
Synonyms: A230065P22Rik, Vam6P, Vam6, mVam6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269338
Homologene: 41025
Wipi2
Name: WD repeat domain, phosphoinositide interacting 2
Synonyms: 1110018O08Rik, 2510001I10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74781
Homologene: 90887
Ppm1g
Name: protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform
Synonyms: Fin13
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14208
HGNC: HGNC:9278
Homologene: 31106
Nif3l1
Name: Ngg1 interacting factor 3-like 1 (S. pombe)
Synonyms: 1110030G24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 65102
Homologene: 5881
Melk
Name: maternal embryonic leucine zipper kinase
Synonyms: MPK38
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17279
Homologene: 32111
Drg2
Name: developmentally regulated GTP binding protein 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13495
HGNC: HGNC:3030
Homologene: 1061
Hey2
Name: hairy/enhancer-of-split related with YRPW motif 2
Synonyms: CHF1, Hrt2, Herp1, Hesr2, bHLHb32
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15214
HGNC: HGNC:4881
Homologene: 22705
D6Wsu163e
Name: DNA segment, Chr 6, Wayne State University 163, expressed
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28040
HGNC: HGNC:1184
Homologene: 10685
Adam12
Name: ADAM metallopeptidase domain 12
Synonyms: Mltna, ADAM12, 5830403F22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11489
HGNC: HGNC:190
Homologene: 74862
Sgk3
Name: serum/glucocorticoid regulated kinase 3
Synonyms: fy, cytokine-independent survival kinase, Cisk, 2510015P22Rik, A330005P07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170755
Homologene: 56582
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Nup50
Name: nucleoporin 50
Synonyms: Npap60, 1700030K07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18141
VEGA: 15
HGNC: HGNC:8065
Homologene: 5190
Knop1
Name: lysine rich nucleolar protein 1
Synonyms: Tsg118, 2310008H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66356
Homologene: 49729
Ddhd2
Name: DDHD domain containing 2
Synonyms: SAMWD1, 2010305K11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72108
Homologene: 66646
Amotl2
Name: angiomotin-like 2
Synonyms: Lccp, MASCOT
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56332
Homologene: 9420
Pnkd
Name: paroxysmal nonkinesiogenic dyskinesia
Synonyms: 2210013N15Rik, 2810403H05Rik, Brp17
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56695
HGNC: HGNC:9153
Homologene: 75045
Akap6
Name: A kinase anchor protein 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Cyb561d2
Name: cytochrome b-561 domain containing 2
Synonyms: 101F6 protein, Tsp10
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56368
Homologene: 38261
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Rapgef4
Name: Rap guanine nucleotide exchange factor (GEF) 4
Synonyms: Epac2, cAMP-GEFII, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56508
Homologene: 4451
Xylt2
Name: xylosyltransferase II
Synonyms: E030002B02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217119
Homologene: 23349
Zim1
Name: zinc finger, imprinted 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22776
Homologene: 129793
Fer1l6
Name: fer-1 like family member 6
Synonyms: EG631797
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 631797
Homologene: 53396
Dner
Name: delta/notch-like EGF repeat containing
Synonyms: BET, A930026D19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227325
Homologene: 26722
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545030
Homologene: 83473
Nwd1
Name: NACHT and WD repeat domain containing 1
Synonyms: A230063L24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319555
Homologene: 72261
Drc3
Name: dynein regulatory complex subunit 3
Synonyms: 4930449E07Rik, m6Bei, Lrrc48
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74665
Homologene: 12581
Brd10
Name: bromodomain containing 10
Synonyms: Gm9832, 9930021J03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240613
Homologene: 19046
Lrrc7
Name: leucine rich repeat containing 7
Synonyms: densin, B230334C09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242274
Homologene: 10817
Scart2
Name: scavenger receptor family member expressed on T cells 2
Synonyms: 5830411N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244234
Homologene: 133218
Nlrp14
Name: NLR family, pyrin domain containing 14
Synonyms: 4921520L01Rik, Nalp14, GC-LRR, Nalp-iota
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76858
Homologene: 18531
Vmn2r70
Name: vomeronasal 2, receptor 70
Synonyms: EG620835
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 670940
Homologene: 115466
Chl1
Name: cell adhesion molecule L1-like
Synonyms: CALL, A530023M13Rik, close homolog of L1, LICAM2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12661
HGNC: HGNC:1939
Homologene: 21314
Rp1l1
Name: retinitis pigmentosa 1 homolog like 1
Synonyms: Dcdc4, Rp1hl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 271209
VEGA: 14
Homologene: 105870
Rora
Name: RAR-related orphan receptor alpha
Synonyms: Nr1f1, 9530021D13Rik, tmgc26
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19883
Homologene: 56594
Hadhb
Name: hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta
Synonyms: 4930479F15Rik, Mtpb
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231086
HGNC: HGNC:4803
Homologene: 153
Rbak
Name: RB-associated KRAB zinc finger
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57782
Homologene: 23287
Med16
Name: mediator complex subunit 16
Synonyms: 95kDa, Trap95, Thrap5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216154
Homologene: 64602
Esp6
Name: exocrine gland secreted peptide 6
Synonyms: Esp5, Gm5494
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 433107
VEGA: 17
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Zfp788
Name: zinc finger protein 788
Synonyms: 2810426N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67607
Homologene: 137363
Sectm1b
Name: secreted and transmembrane 1B
Synonyms: K12, 1810003C24Rik, Sectm1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 58210
Homologene: 86740
H2-T10
Name: histocompatibility 2, T region locus 10
Synonyms: H-2T10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15024
Mst1
Name: macrophage stimulating 1 (hepatocyte growth factor-like)
Synonyms: DNF15S2h, D9H3F15S2, D3F15S2h, Hgfl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15235
Homologene: 7360
Nacad
Name: NAC alpha domain containing
Synonyms: mKIAA0363
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192950
Homologene: 135717
Ecm1
Name: extracellular matrix protein 1
Synonyms: p85
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13601
HGNC: HGNC:3153
Homologene: 3260
Pate8
Name: prostate and testis expressed 8
Synonyms: Gm17689
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100312948
Or5an9
Name: olfactory receptor family 5 subfamily AN member 9
Synonyms: GA_x6K02T2RE5P-2573738-2574676, MOR214-5, Olfr1431
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258409
Homologene: 115495
Ifit1bl1
Name: interferon induced protein with tetratricpeptide repeats 1B like 1
Synonyms: Gm14446
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 667373
Homologene: 78213
Tha1
Name: threonine aldolase 1
Synonyms: GLY1, 1300017K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71776
Homologene: 57081
Zfp28
Name: zinc finger protein 28
Synonyms: mkr-5, Zfp-28, 2810438M17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22690
Homologene: 69047
Ift27
Name: intraflagellar transport 27
Synonyms: 2600013G09Rik, Rabl4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67042
VEGA: 15
Homologene: 4998
Tmem39b
Name: transmembrane protein 39b
Synonyms: 6330509E05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230770
Homologene: 23069
Nek5
Name: NIMA (never in mitosis gene a)-related expressed kinase 5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330721
HGNC: HGNC:7748
Homologene: 87952
Tex44
Name: testis expressed 44
Synonyms: 1700019O17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71863
Homologene: 51874
Tgfbr2
Name: transforming growth factor, beta receptor II
Synonyms: TbetaR-II, TbetaRII, 1110020H15Rik, TBR-II
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21813
VEGA: 9
Homologene: 2435
Gzme
Name: granzyme E
Synonyms: MCSP-2, CCP3, Ctla-6, Ctla6
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14942
VEGA: 14
Homologene: 133275
4932415M13Rik
Name: RIKEN cDNA 4932415M13 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211496
Spata31d1e
Name: spermatogenesis associated 31 subfamily D, member 1E
Synonyms: 1700014D04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 102638268
Homologene: 140986
Gsta1
Name: glutathione S-transferase, alpha 1 (Ya)
Synonyms: Gst2-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14857
Homologene: 74378
4930430O22Rik
Name: RIKEN cDNA 4930430O22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Hoxa11
Name: homeobox A11
Synonyms: Hoxa-11, Hox-1.9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15396
HGNC: HGNC:5101
Homologene: 4033
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 9,872,293 bp
  • C to T, chromosome 1 at 34,252,998 bp
  • C to A, chromosome 1 at 58,447,726 bp
  • A to G, chromosome 1 at 74,349,391 bp
  • CGCTGCTGCTGCTGCTGCTGCTGCTGC to CGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 84,585,549 bp
  • G to T, chromosome 1 at 86,427,186 bp
  • T to A, chromosome 1 at 135,966,669 bp
  • T to G, chromosome 2 at 72,055,026 bp
  • T to A, chromosome 2 at 76,724,993 bp
  • A to T, chromosome 2 at 120,323,648 bp
  • A to T, chromosome 3 at 31,043,792 bp
  • G to A, chromosome 3 at 56,002,790 bp
  • G to A, chromosome 3 at 95,735,963 bp
  • T to C, chromosome 3 at 158,186,970 bp
  • T to A, chromosome 4 at 44,308,937 bp
  • T to A, chromosome 4 at 88,628,834 bp
  • C to T, chromosome 4 at 118,235,964 bp
  • T to A, chromosome 4 at 123,510,977 bp
  • T to C, chromosome 4 at 129,676,663 bp
  • A to G, chromosome 5 at 30,169,494 bp
  • T to C, chromosome 5 at 31,203,121 bp
  • C to T, chromosome 5 at 115,436,379 bp
  • T to A, chromosome 5 at 142,659,638 bp
  • T to C, chromosome 5 at 143,174,344 bp
  • G to T, chromosome 6 at 52,243,456 bp
  • A to G, chromosome 6 at 103,647,287 bp
  • A to G, chromosome 6 at 126,954,770 bp
  • T to G, chromosome 7 at 6,389,745 bp
  • A to G, chromosome 7 at 6,682,125 bp
  • T to G, chromosome 7 at 41,649,075 bp
  • T to A, chromosome 7 at 55,825,707 bp
  • T to C, chromosome 7 at 85,559,167 bp
  • T to G, chromosome 7 at 107,190,122 bp
  • C to T, chromosome 7 at 118,853,050 bp
  • T to A, chromosome 7 at 133,930,025 bp
  • T to C, chromosome 7 at 140,295,830 bp
  • C to T, chromosome 8 at 22,096,790 bp
  • A to G, chromosome 8 at 25,753,128 bp
  • C to T, chromosome 8 at 72,657,086 bp
  • G to A, chromosome 9 at 36,581,324 bp
  • A to G, chromosome 9 at 69,364,385 bp
  • A to T, chromosome 9 at 78,242,493 bp
  • A to T, chromosome 9 at 102,730,897 bp
  • A to T, chromosome 9 at 107,540,400 bp
  • G to T, chromosome 9 at 108,081,650 bp
  • A to C, chromosome 9 at 116,109,557 bp
  • A to G, chromosome 10 at 30,840,382 bp
  • A to T, chromosome 10 at 79,903,100 bp
  • A to G, chromosome 11 at 6,602,217 bp
  • A to G, chromosome 11 at 23,284,863 bp
  • A to G, chromosome 11 at 60,388,889 bp
  • T to C, chromosome 11 at 60,459,527 bp
  • A to C, chromosome 11 at 94,669,567 bp
  • A to G, chromosome 11 at 117,869,563 bp
  • A to T, chromosome 11 at 117,967,568 bp
  • G to A, chromosome 11 at 121,055,826 bp
  • C to T, chromosome 12 at 52,796,087 bp
  • A to T, chromosome 13 at 59,742,903 bp
  • T to A, chromosome 14 at 33,100,966 bp
  • T to A, chromosome 14 at 56,118,712 bp
  • C to T, chromosome 14 at 64,029,047 bp
  • T to A, chromosome 14 at 79,580,638 bp
  • T to C, chromosome 15 at 58,637,970 bp
  • A to G, chromosome 15 at 76,057,922 bp
  • A to G, chromosome 15 at 78,165,236 bp
  • T to A, chromosome 15 at 84,939,727 bp
  • T to A, chromosome 15 at 85,902,101 bp
  • T to A, chromosome 17 at 34,135,750 bp
  • A to T, chromosome 17 at 36,121,146 bp
  • T to A, chromosome 17 at 40,562,925 bp
  • T to A, chromosome 17 at 43,627,607 bp
  • A to T, chromosome 17 at 45,408,364 bp
  • A to T, chromosome 17 at 53,725,045 bp
  • C to T, chromosome 18 at 20,595,950 bp
  • T to A, chromosome 19 at 12,209,750 bp
  • G to A, chromosome 19 at 29,719,345 bp
  • A to G, chromosome 19 at 34,594,641 bp
  • A to T, chromosome 19 at 60,768,726 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1483 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039536-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.