Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1495Btlr/Mmmh
Stock Number:
039546-MU
Citation ID:
RRID:MMRRC_039546-MU
Other Names:
R1495 (G1), C57BL/6J-MtgxR1495Btlr
Major Collection:

Strain Information

Suz12
Name: SUZ12 polycomb repressive complex 2 subunit
Synonyms: 2610028O16Rik, D11Ertd530e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52615
Homologene: 32256
Aggf1
Name: angiogenic factor with G patch and FHA domains 1
Synonyms: 2310029P06Rik, VG5Q, 2010009L17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66549
Homologene: 41220
Slc12a6
Name: solute carrier family 12, member 6
Synonyms: KCC3, gaxp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107723
Homologene: 21069
Cdh3
Name: cadherin 3
Synonyms: P-cadherin, Cadp, Pcad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12560
HGNC: HGNC:1762
Homologene: 20425
Psen2
Name: presenilin 2
Synonyms: ALG-3, PS-2, PS2, Ad4h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19165
HGNC: HGNC:9509
Homologene: 386
Agt
Name: angiotensinogen
Synonyms: Aogen, Serpina8, angiotensin precursor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11606
HGNC: HGNC:333
Homologene: 14
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 17,091,652 bp
  • T to C, chromosome 1 at 72,643,291 bp
  • A to G, chromosome 1 at 74,523,600 bp
  • A to T, chromosome 1 at 107,451,660 bp
  • C to T, chromosome 1 at 143,799,937 bp
  • T to C, chromosome 1 at 177,103,042 bp
  • C to T, chromosome 1 at 180,228,854 bp
  • T to A, chromosome 2 at 31,640,193 bp
  • T to A, chromosome 2 at 36,245,032 bp
  • A to G, chromosome 2 at 49,536,663 bp
  • T to C, chromosome 2 at 112,354,190 bp
  • T to C, chromosome 2 at 113,290,791 bp
  • T to G, chromosome 2 at 118,760,532 bp
  • T to C, chromosome 2 at 154,500,558 bp
  • A to G, chromosome 2 at 179,933,027 bp
  • T to A, chromosome 3 at 129,713,006 bp
  • C to T, chromosome 3 at 129,990,287 bp
  • C to A, chromosome 4 at 21,797,385 bp
  • A to T, chromosome 4 at 83,681,095 bp
  • G to A, chromosome 4 at 108,266,213 bp
  • TGCGTTGCACCGATACCGGG to TG, chromosome 4 at 134,357,677 bp
  • T to C, chromosome 4 at 148,249,825 bp
  • A to G, chromosome 5 at 23,499,327 bp
  • A to T, chromosome 5 at 72,786,755 bp
  • A to G, chromosome 5 at 96,528,586 bp
  • A to G, chromosome 5 at 134,518,042 bp
  • T to C, chromosome 6 at 39,581,844 bp
  • T to G, chromosome 6 at 41,771,903 bp
  • T to A, chromosome 6 at 57,003,073 bp
  • T to C, chromosome 6 at 124,449,917 bp
  • A to G, chromosome 6 at 147,534,172 bp
  • T to A, chromosome 7 at 4,580,889 bp
  • T to A, chromosome 7 at 29,777,303 bp
  • T to A, chromosome 7 at 116,388,065 bp
  • A to G, chromosome 7 at 119,578,126 bp
  • T to A, chromosome 8 at 21,095,201 bp
  • C to T, chromosome 8 at 106,538,997 bp
  • T to C, chromosome 8 at 111,197,675 bp
  • T to G, chromosome 8 at 112,881,763 bp
  • A to G, chromosome 8 at 124,559,455 bp
  • T to C, chromosome 9 at 8,626,789 bp
  • T to C, chromosome 9 at 14,308,521 bp
  • T to A, chromosome 9 at 66,096,597 bp
  • T to A, chromosome 10 at 51,628,437 bp
  • T to C, chromosome 11 at 42,154,944 bp
  • T to A, chromosome 11 at 55,262,673 bp
  • C to T, chromosome 11 at 59,080,160 bp
  • T to A, chromosome 11 at 76,218,450 bp
  • T to A, chromosome 11 at 80,010,652 bp
  • A to G, chromosome 11 at 101,099,144 bp
  • T to C, chromosome 11 at 106,688,856 bp
  • T to C, chromosome 12 at 50,366,352 bp
  • A to T, chromosome 13 at 62,774,270 bp
  • G to T, chromosome 13 at 68,796,535 bp
  • G to A, chromosome 13 at 95,356,413 bp
  • A to G, chromosome 13 at 98,749,850 bp
  • A to G, chromosome 13 at 119,477,820 bp
  • A to T, chromosome 14 at 65,075,867 bp
  • T to G, chromosome 15 at 8,351,280 bp
  • G to A, chromosome 15 at 20,665,507 bp
  • C to T, chromosome 15 at 79,626,245 bp
  • G to A, chromosome 15 at 101,573,873 bp
  • T to A, chromosome 16 at 18,389,386 bp
  • A to T, chromosome 16 at 22,500,379 bp
  • T to C, chromosome 17 at 36,127,898 bp
  • A to G, chromosome 17 at 37,055,940 bp
  • C to T, chromosome 17 at 56,705,527 bp
  • G to T, chromosome 18 at 4,181,192 bp
  • A to T, chromosome 18 at 10,004,994 bp
  • T to A, chromosome 18 at 12,758,839 bp
  • T to A, chromosome 18 at 84,851,480 bp
  • T to G, chromosome 19 at 4,718,976 bp
  • C to G, chromosome 19 at 25,410,349 bp
  • A to G, chromosome 19 at 34,877,680 bp
  • A to G, chromosome 19 at 44,005,508 bp
  • T to C, chromosome X at 37,163,965 bp
  • C to A, chromosome X at 137,015,335 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1495 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039546-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.