Strain Name:
C57BL/6J-MtgxR1619Btlr/Mmmh
Stock Number:
039656-MU
Citation ID:
RRID:MMRRC_039656-MU
Other Names:
R1619 (G1), C57BL/6J-MtgxR1619Btlr
Major Collection:

Gene Information

Edn3
Name: endothelin 3
Synonyms: tmgc48, 114CH19, 114-CH19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 13616
HGNC: HGNC:3178
Homologene: 88
Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: 410I21.SP6, D16Jhu34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 110948
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
Chrna5
Name: cholinergic receptor, nicotinic, alpha polypeptide 5
Synonyms: Acra-5, Acra5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 110835
VEGA: 9
HGNC: HGNC:1959
Homologene: 55485
Pdgfc
Name: platelet-derived growth factor, C polypeptide
Synonyms: PDGF-C, 1110064L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 54635
HGNC: HGNC:8801
Homologene: 9423
Ulk2
Name: unc-51 like kinase 2
Synonyms: Unc51.2, A830085I22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 29869
Homologene: 5891
Nap1l1
Name: nucleosome assembly protein 1-like 1
Synonyms: D10Ertd68e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 53605
VEGA: 10
HGNC: HGNC:7637
Homologene: 129218
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, D630035I23Rik, 5430433L24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 108829
Homologene: 3129
Fgd4
Name: FYVE, RhoGEF and PH domain containing 4
Synonyms: Frabin-alpha, Frabin-gamma, Frabin-beta, ZFYVE6, Frabin, 9330209B17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 224014
Homologene: 26727
Pdia3
Name: protein disulfide isomerase associated 3
Synonyms: Erp, Plca, PDI, Grp58, ERp61, PDI-Q2, ERp57, ERp60
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 14827
HGNC: HGNC:4606
Homologene: 68454
Lrrc2
Name: leucine rich repeat containing 2
Synonyms: 4933431K03Rik, 2400002D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 74249
Homologene: 23454
Scrib
Name: scribbled planar cell polarity
Synonyms: Scrb1, Crc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 105782
Homologene: 44228
Pard3
Name: par-3 family cell polarity regulator
Synonyms: PAR-3, Pard3a, Par3, ASIP, D8Ertd580e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 93742
Homologene: 10489
Cep97
Name: centrosomal protein 97
Synonyms: E130116N02Rik, Lrriq2, 4932439K18Rik, 2810403B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 74201
Homologene: 11579
Phf20l1
Name: PHD finger protein 20-like 1
Synonyms: E130113K22Rik, CGI-72
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 239510
VEGA: 15
Homologene: 9341
Chchd6
Name: coiled-coil-helix-coiled-coil-helix domain containing 6
Synonyms: Micos25, 0710001P09Rik, 1700021B03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 66098
Homologene: 11920
Esrrb
Name: estrogen related receptor, beta
Synonyms: Err2, ERR2, ERRb, Estrrb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 26380
HGNC: HGNC:3473
Homologene: 69108
Helz
Name: helicase with zinc finger domain
Synonyms: 3110078M01Rik, 9630002H22Rik, 9430093I07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 78455
Homologene: 8918
Zfr
Name: zinc finger RNA binding protein
Synonyms: C920030H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 22763
Homologene: 8009
Epc2
Name: enhancer of polycomb homolog 2
Synonyms: D2Ertd694e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 227867
Homologene: 32274
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, 4632404O06Rik, 2810004D21Rik, Ndrp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 83946
Homologene: 41209
Actn1
Name: actinin, alpha 1
Synonyms: 3110023F10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 109711
VEGA: 12
HGNC: HGNC:163
Homologene: 55553
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ankyrin-G, 2900054D09Rik, Ankyrin-3, AnkG, Ank-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Rapsn
Name: receptor-associated protein of the synapse
Synonyms: rapsyn, 43kDa acetylcholine receptor-associated protein, Raps, Nraps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 19400
HGNC: HGNC:9863
Homologene: 3708
Rims2
Name: regulating synaptic membrane exocytosis 2
Synonyms: 2810036I15Rik, RIM2, Syt3-rs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 116838
VEGA: 15
Homologene: 81639
Slc25a46
Name: solute carrier family 25, member 46
Synonyms: 1200007B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 67453
VEGA: 18
Homologene: 14518
Cul5
Name: cullin 5
Synonyms: C030032G03Rik, 4921514I20Rik, 8430423K24Rik, VACM-1, C330021I08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 75717
HGNC: HGNC:2556
Homologene: 2597
Erap1
Name: endoplasmic reticulum aminopeptidase 1
Synonyms: PILSAP, Arts1, ERAAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 80898
VEGA: 13
Homologene: 56754
Setd1a
Name: SET domain containing 1A
Synonyms: KMT2F
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233904
Homologene: 52251
Agr3
Name: anterior gradient 3
Synonyms: LOC380754, E030025L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 403205
Homologene: 45551
Chd1l
Name: chromodomain helicase DNA binding protein 1-like
Synonyms: 4432404A22Rik, Snf2p
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 68058
HGNC: HGNC:1916
Homologene: 11590
Stard3
Name: START domain containing 3
Synonyms: es64, Mln64
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 59045
Homologene: 38227
Nepro
Name: nucleolus and neural progenitor protein
Synonyms: BC027231
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 212547
Homologene: 9127
Dlat
Name: dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex)
Synonyms: 6332404G05Rik, PDC-E2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235339
HGNC: HGNC:2896
Homologene: 6814
Dse
Name: dermatan sulfate epimerase
Synonyms: B130024B19Rik, Sart2, DS-epi1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 212898
VEGA: 10
Homologene: 8354
Zfp940
Name: zinc finger protein 940
Synonyms: BC027344
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233057
Homologene: 138421
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 171395
Homologene: 51376
Susd2
Name: sushi domain containing 2
Synonyms: 1200011D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 71733
VEGA: 10
Homologene: 10481
Grm2
Name: glutamate receptor, metabotropic 2
Synonyms: mGluR2, 4930441L02Rik, Gprc1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 108068
HGNC: HGNC:4594
Homologene: 20229
Nobox
Name: NOBOX oogenesis homeobox
Synonyms: Og2x
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 18291
Homologene: 51066
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: Cav1.2, L-type Cav1.2, D930026N18Rik, Cchl1a1, (alpha)1 subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Adamts6
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6
Synonyms: b2b2029Clo, b2b2182Clo, b2b1879.1Clo, b2b2187.1Clo, ADAM-TS6, b2b2228Clo, A930019D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 108154
VEGA: 13
HGNC: HGNC:222
Homologene: 82573
Trpm3
Name: transient receptor potential cation channel, subfamily M, member 3
Synonyms: B930001P07Rik, 6330504P12Rik, MLSN2, LTRPC3, melastatin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 226025
VEGA: 19
Homologene: 62287
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 672511
Homologene: 45439
Olfr1484
Name: olfactory receptor 1484
Synonyms: GA_x6K02T2RE5P-3917859-3918806, MOR202-37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 258288
Homologene: 110492
Intu
Name: inturned planar cell polarity protein
Synonyms: 9230116I04Rik, Pdzd6, Pdzk6, 9430087H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 380614
Homologene: 41059
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Pcdh10
Name: protocadherin 10
Synonyms: 6430703F07Rik, OL-pc, 6430521D13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 18526
Homologene: 74967
Ces2g
Name: carboxylesterase 2G
Synonyms: 2210023G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 72361
HGNC: HGNC:1864
Homologene: 77154
Abcb11
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 11
Synonyms: sister of P-glycoprotein, Bsep, PGY4, ABC16, PFIC2, Lith1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Col19a1
Name: collagen, type XIX, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12823
HGNC: HGNC:2196
Homologene: 55608
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 239420
Homologene: 65982
Abca9
Name: ATP-binding cassette, sub-family A (ABC1), member 9
Synonyms: D630040K07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217262
HGNC: HGNC:39
Homologene: 33332
Guf1
Name: GUF1 homolog, GTPase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231279
Homologene: 6505
Olfr1281
Name: olfactory receptor 1281
Synonyms: MOR248-18, GA_x6K02T2Q125-72379864-72380781, MOR248-14P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 257979
Homologene: 73992
Rfx6
Name: regulatory factor X, 6
Synonyms: Rfxdc1, 4930572O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 320995
Homologene: 18318
Ripor3
Name: RIPOR family member 3
Synonyms: 2310033K02Rik, Fam65c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 69553
Homologene: 15438
Pappa
Name: pregnancy-associated plasma protein A
Synonyms: 8430414N03Rik, PAPP-A, PAG1, IGFBP-4ase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 18491
HGNC: HGNC:8602
Homologene: 31097
Gpat2
Name: glycerol-3-phosphate acyltransferase 2, mitochondrial
Synonyms: A530057A03Rik, Gpat2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 215456
Homologene: 19037
Ift140
Name: intraflagellar transport 140
Synonyms: Tce5, Wdtc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 106633
Homologene: 40979
Col16a1
Name: collagen, type XVI, alpha 1
Synonyms: A530052M23Rik, 2700007F12Rik, [a]1 (XVI) collagen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 107581
HGNC: HGNC:2193
Homologene: 1397
Actn3
Name: actinin alpha 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 11474
HGNC: HGNC:165
Homologene: 862
Ntn4
Name: netrin 4
Synonyms: beta-netrin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 57764
Homologene: 10934
Grid2
Name: glutamate receptor, ionotropic, delta 2
Synonyms: GluRdelta2, tpr, B230104L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 14804
HGNC: HGNC:4576
Homologene: 74399
Csf2rb
Name: colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Synonyms: Csf2rb1, CDw131, Il5rb, Il3rb1, Il3r, AIC2B, Bc, beta c, common beta chain
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 12983
VEGA: 15
HGNC: HGNC:2436
Homologene: 339
Hipk3
Name: homeodomain interacting protein kinase 3
Synonyms: DYRK6, FIST3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 15259
HGNC: HGNC:4915
Homologene: 55923
Kif26b
Name: kinesin family member 26B
Synonyms: N-11 kinesin, D230039L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 269152
Homologene: 18623
Dsg1c
Name: desmoglein 1 gamma
Synonyms: Dsg6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 211924
HGNC: HGNC:3048
Xkr6
Name: X-linked Kx blood group related 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 219149
Homologene: 18287
Ccdc42
Name: coiled-coil domain containing 42
Synonyms: A530001H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 276920
Homologene: 44902
Cckar
Name: cholecystokinin A receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 12425
HGNC: HGNC:1570
Homologene: 37337
Dmwd
Name: dystrophia myotonica-containing WD repeat motif
Synonyms: 59, Dm9, DMR-N9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 13401
HGNC: HGNC:2936
Homologene: 22559
Slc9b1
Name: solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Synonyms: 4933424B12Rik, 4933425K02Rik, 1700094G20Rik, Nhedc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 74446
Homologene: 49914
D630004N19Rik
Name: RIKEN cDNA D630004N19 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
Trim62
Name: tripartite motif-containing 62
Synonyms: 6330414G21Rik, Dear1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 67525
Homologene: 10071
Scgb2b27
Name: secretoglobin, family 2B, member 27
Synonyms: Abpbg5, Abpbg27, Abpb, C2a, Scgb2b5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233099
Homologene: 83171
Galc
Name: galactosylceramidase
Synonyms: A930008M05Rik, galactocerebrosidase, Gacy, 2310068B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 14420
VEGA: 12
HGNC: HGNC:4115
Homologene: 124
Hdac10
Name: histone deacetylase 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 170787
Homologene: 23749
Socs4
Name: suppressor of cytokine signaling 4
Synonyms: Socs7, A730004F22Rik, 3110032M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 67296
Homologene: 15442
Fam75d3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
Parp14
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: 1600029O10Rik, CoaSt6, collaborator of Stat6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 547253
Homologene: 19697
Actg2
Name: actin, gamma 2, smooth muscle, enteric
Synonyms: Act4, Acta3, Act-4, SMGA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 11468
HGNC: HGNC:145
Homologene: 123845
Cela2a
Name: chymotrypsin-like elastase family, member 2A
Synonyms: Ela-2, Ela2, Ela2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 13706
Homologene: 40598
Olfr385
Name: olfactory receptor 385
Synonyms: MOR135-3, GA_x6K02T2P1NL-3760313-3759375
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 259025
Homologene: 133670
Dip2a
Name: disco interacting protein 2 homolog A
Synonyms: 4931420H10Rik, Kiaa0184-hp, Dip2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 64451
Homologene: 41012
Ttc4
Name: tetratricopeptide repeat domain 4
Synonyms: 2810002P21Rik, L62
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 72354
Homologene: 31249
Bco1
Name: beta-carotene oxygenase 1
Synonyms: Bcdo, beta-CD, betaCMOOX, Cmoi, Bcdo1, Bcmo1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 63857
Homologene: 41172
Olfr644
Name: olfactory receptor 644
Synonyms: MOR13-1, GA_x6K02T2PBJ9-6803062-6802118
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 259125
Homologene: 17491
Olfr823
Name: olfactory receptor 823
Synonyms: GA_x6K02T2PULF-11783479-11782532, MOR210-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 258668
Homologene: 45026
BC051019
Name: cDNA sequence BC051019
Synonyms: D7H11orf16, ICRFP703N2430Q5.5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 57355
HGNC: HGNC:1169
Homologene: 49631
Abca7
Name: ATP-binding cassette, sub-family A (ABC1), member 7
Synonyms: Abc51
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 27403
HGNC: HGNC:37
Homologene: 22783
Tmem132a
Name: transmembrane protein 132A
Synonyms: Hspa5bp1, 6720481D13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 98170
Homologene: 75076
Tll1
Name: tolloid-like
Synonyms: Tll-1, b2b2476Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 21892
Homologene: 49202
Olfr71
Name: olfactory receptor 71
Synonyms: mOR17, GA_x6K02T2N78B-16230286-16231224, MOR262-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 56015
Homologene: 10460
Nkain4
Name: Na+/K+ transporting ATPase interacting 4
Synonyms: C030019F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 58237
Homologene: 10978
Fech
Name: ferrochelatase
Synonyms: fch, Fcl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 14151
VEGA: 18
HGNC: HGNC:3647
Homologene: 113
4921506M07Rik
Name: RIKEN cDNA 4921506M07 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
Plekhg2
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 2
Synonyms: Clg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 101497
Homologene: 16341
Rtp2
Name: receptor transporter protein 2
Synonyms: LOC224055
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 224055
VEGA: 16
Homologene: 19503
Mup9
Name: major urinary protein 9
Synonyms: Gm14076
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 100038948
Homologene: 74304
Vmn2r38
Name: vomeronasal 2, receptor 38
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 434110
Homologene: 113703
Srcin1
Name: SRC kinase signaling inhibitor 1
Synonyms: p140Cap, P140
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 56013
Homologene: 10324
AB512673.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 24,534,091 bp
  • A to G, chromosome 1 at 178,916,478 bp
  • A to G, chromosome 2 at 40,697,589 bp
  • G to A, chromosome 2 at 49,549,978 bp
  • G to A, chromosome 2 at 69,286,661 bp
  • A to G, chromosome 2 at 91,043,159 bp
  • A to T, chromosome 2 at 104,434,502 bp
  • A to G, chromosome 2 at 111,328,961 bp
  • G to A, chromosome 2 at 121,432,377 bp
  • A to G, chromosome 2 at 127,428,717 bp
  • T to C, chromosome 2 at 167,980,845 bp
  • A to T, chromosome 2 at 174,779,765 bp
  • A to G, chromosome 2 at 180,936,001 bp
  • T to A, chromosome 3 at 40,697,631 bp
  • A to G, chromosome 3 at 45,380,312 bp
  • T to C, chromosome 3 at 81,174,887 bp
  • C to T, chromosome 3 at 97,582,731 bp
  • A to G, chromosome 3 at 135,355,004 bp
  • A to G, chromosome 4 at 43,706,292 bp
  • A to G, chromosome 4 at 60,421,879 bp
  • A to G, chromosome 4 at 65,176,229 bp
  • A to G, chromosome 4 at 106,665,646 bp
  • A to G, chromosome 4 at 128,909,488 bp
  • G to A, chromosome 4 at 130,098,940 bp
  • A to G, chromosome 4 at 141,825,941 bp
  • A to T, chromosome 5 at 53,700,067 bp
  • A to G, chromosome 5 at 69,559,639 bp
  • A to T, chromosome 6 at 43,307,467 bp
  • G to A, chromosome 6 at 64,094,448 bp
  • T to A, chromosome 6 at 83,523,187 bp
  • G to T, chromosome 6 at 89,419,754 bp
  • C to T, chromosome 6 at 118,612,625 bp
  • C to A, chromosome 7 at 9,075,533 bp
  • TAGCCTGGGAA to TAGCCTGGGAAGCCTGGGAA, chromosome 7 at 19,081,034 bp
  • T to C, chromosome 7 at 28,368,421 bp
  • G to A, chromosome 7 at 29,845,537 bp
  • A to T, chromosome 7 at 34,012,132 bp
  • G to A, chromosome 7 at 100,546,275 bp
  • T to C, chromosome 7 at 104,068,531 bp
  • T to A, chromosome 7 at 109,718,062 bp
  • T to A, chromosome 7 at 127,784,837 bp
  • C to A, chromosome 8 at 64,056,273 bp
  • A to T, chromosome 8 at 104,967,352 bp
  • T to C, chromosome 8 at 117,108,715 bp
  • C to A, chromosome 8 at 127,380,502 bp
  • A to T, chromosome 9 at 50,640,352 bp
  • G to T, chromosome 9 at 53,658,593 bp
  • A to G, chromosome 9 at 55,004,365 bp
  • A to T, chromosome 9 at 82,871,449 bp
  • T to A, chromosome 9 at 106,647,471 bp
  • T to A, chromosome 9 at 110,960,973 bp
  • T to C, chromosome 10 at 34,153,234 bp
  • A to T, chromosome 10 at 51,722,994 bp
  • T to C, chromosome 10 at 67,219,875 bp
  • T to C, chromosome 10 at 69,879,975 bp
  • G to T, chromosome 10 at 75,638,044 bp
  • A to T, chromosome 10 at 76,286,350 bp
  • A to T, chromosome 10 at 80,009,055 bp
  • C to A, chromosome 10 at 93,644,734 bp
  • G to A, chromosome 10 at 111,493,379 bp
  • A to G, chromosome 10 at 130,112,679 bp
  • A to G, chromosome 11 at 8,950,413 bp
  • A to T, chromosome 11 at 61,781,746 bp
  • A to G, chromosome 11 at 68,594,289 bp
  • A to T, chromosome 11 at 73,589,292 bp
  • A to G, chromosome 11 at 97,525,481 bp
  • T to A, chromosome 11 at 98,376,609 bp
  • T to A, chromosome 11 at 107,636,279 bp
  • T to A, chromosome 11 at 110,106,515 bp
  • T to C, chromosome 11 at 119,420,234 bp
  • G to A, chromosome 12 at 35,947,859 bp
  • T to C, chromosome 12 at 57,737,668 bp
  • G to A, chromosome 12 at 80,173,022 bp
  • T to C, chromosome 12 at 86,514,500 bp
  • A to T, chromosome 12 at 98,234,304 bp
  • A to T, chromosome 13 at 59,702,433 bp
  • T to A, chromosome 13 at 74,671,381 bp
  • C to T, chromosome 13 at 104,312,777 bp
  • T to A, chromosome 14 at 47,290,283 bp
  • G to A, chromosome 14 at 63,819,317 bp
  • C to A, chromosome 15 at 12,150,387 bp
  • A to C, chromosome 15 at 39,506,986 bp
  • G to A, chromosome 15 at 47,949,950 bp
  • A to T, chromosome 15 at 66,615,259 bp
  • G to A, chromosome 15 at 76,049,543 bp
  • A to G, chromosome 15 at 78,335,211 bp
  • G to T, chromosome 15 at 89,126,675 bp
  • T to C, chromosome 16 at 16,424,056 bp
  • A to T, chromosome 16 at 23,930,671 bp
  • G to A, chromosome 16 at 35,856,760 bp
  • A to G, chromosome 16 at 44,727,028 bp
  • A to T, chromosome 16 at 55,927,796 bp
  • G to A, chromosome 16 at 94,231,343 bp
  • A to G, chromosome 17 at 25,088,865 bp
  • A to G, chromosome 18 at 20,264,842 bp
  • T to C, chromosome 18 at 31,583,489 bp
  • A to T, chromosome 18 at 64,462,118 bp
  • C to T, chromosome 19 at 4,865,455 bp
  • C to G, chromosome 19 at 10,861,698 bp
  • T to A, chromosome 19 at 13,585,614 bp
  • A to G, chromosome 19 at 22,711,907 bp
  • A to T, chromosome X at 170,675,877 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1619 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039656-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.