Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1619Btlr/Mmmh
Stock Number:
039656-MU
Citation ID:
RRID:MMRRC_039656-MU
Other Names:
R1619 (G1), C57BL/6J-MtgxR1619Btlr
Major Collection:

Strain Information

Edn3
Name: endothelin 3
Synonyms: 114CH19, 114-CH19, tmgc48
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13616
HGNC: HGNC:3178
Homologene: 88
Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: 410I21.SP6, D16Jhu34
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110948
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
Chrna5
Name: cholinergic receptor, nicotinic, alpha polypeptide 5
Synonyms: Acra-5, Acra5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110835
VEGA: 9
HGNC: HGNC:1959
Homologene: 55485
Pdgfc
Name: platelet-derived growth factor, C polypeptide
Synonyms: 1110064L01Rik, PDGF-C
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54635
HGNC: HGNC:8801
Homologene: 9423
Ulk2
Name: unc-51 like kinase 2
Synonyms: Unc51.2, A830085I22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 29869
Homologene: 5891
Nap1l1
Name: nucleosome assembly protein 1-like 1
Synonyms: D10Ertd68e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 53605
VEGA: 10
HGNC: HGNC:7637
Homologene: 129218
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 24,534,091 bp
  • A to G, chromosome 1 at 178,916,478 bp
  • A to G, chromosome 2 at 40,697,589 bp
  • G to A, chromosome 2 at 49,549,978 bp
  • G to A, chromosome 2 at 69,286,661 bp
  • A to G, chromosome 2 at 91,043,159 bp
  • A to T, chromosome 2 at 104,434,502 bp
  • A to G, chromosome 2 at 111,328,961 bp
  • G to A, chromosome 2 at 121,432,377 bp
  • A to G, chromosome 2 at 127,428,717 bp
  • T to C, chromosome 2 at 167,980,845 bp
  • A to T, chromosome 2 at 174,779,765 bp
  • A to G, chromosome 2 at 180,936,001 bp
  • T to A, chromosome 3 at 40,697,631 bp
  • A to G, chromosome 3 at 45,380,312 bp
  • T to C, chromosome 3 at 81,174,887 bp
  • C to T, chromosome 3 at 97,582,731 bp
  • A to G, chromosome 3 at 135,355,004 bp
  • A to G, chromosome 4 at 43,706,292 bp
  • A to G, chromosome 4 at 60,421,879 bp
  • A to G, chromosome 4 at 65,176,229 bp
  • A to G, chromosome 4 at 106,665,646 bp
  • A to G, chromosome 4 at 128,909,488 bp
  • G to A, chromosome 4 at 130,098,940 bp
  • A to G, chromosome 4 at 141,825,941 bp
  • A to T, chromosome 5 at 53,700,067 bp
  • A to G, chromosome 5 at 69,559,639 bp
  • A to T, chromosome 6 at 43,307,467 bp
  • G to A, chromosome 6 at 64,094,448 bp
  • T to A, chromosome 6 at 83,523,187 bp
  • G to T, chromosome 6 at 89,419,754 bp
  • C to T, chromosome 6 at 118,612,625 bp
  • C to A, chromosome 7 at 9,075,533 bp
  • TAGCCTGGGAA to TAGCCTGGGAAGCCTGGGAA, chromosome 7 at 19,081,034 bp
  • T to C, chromosome 7 at 28,368,421 bp
  • G to A, chromosome 7 at 29,845,537 bp
  • A to T, chromosome 7 at 34,012,132 bp
  • G to A, chromosome 7 at 100,546,275 bp
  • T to C, chromosome 7 at 104,068,531 bp
  • T to A, chromosome 7 at 109,718,062 bp
  • T to A, chromosome 7 at 127,784,837 bp
  • C to A, chromosome 8 at 64,056,273 bp
  • A to T, chromosome 8 at 104,967,352 bp
  • T to C, chromosome 8 at 117,108,715 bp
  • C to A, chromosome 8 at 127,380,502 bp
  • A to T, chromosome 9 at 50,640,352 bp
  • G to T, chromosome 9 at 53,658,593 bp
  • A to G, chromosome 9 at 55,004,365 bp
  • A to T, chromosome 9 at 82,871,449 bp
  • T to A, chromosome 9 at 106,647,471 bp
  • T to A, chromosome 9 at 110,960,973 bp
  • T to C, chromosome 10 at 34,153,234 bp
  • A to T, chromosome 10 at 51,722,994 bp
  • T to C, chromosome 10 at 67,219,875 bp
  • T to C, chromosome 10 at 69,879,975 bp
  • G to T, chromosome 10 at 75,638,044 bp
  • A to T, chromosome 10 at 76,286,350 bp
  • A to T, chromosome 10 at 80,009,055 bp
  • C to A, chromosome 10 at 93,644,734 bp
  • G to A, chromosome 10 at 111,493,379 bp
  • A to G, chromosome 10 at 130,112,679 bp
  • A to G, chromosome 11 at 8,950,413 bp
  • A to T, chromosome 11 at 61,781,746 bp
  • A to G, chromosome 11 at 68,594,289 bp
  • A to T, chromosome 11 at 73,589,292 bp
  • A to G, chromosome 11 at 97,525,481 bp
  • T to A, chromosome 11 at 98,376,609 bp
  • T to A, chromosome 11 at 107,636,279 bp
  • T to A, chromosome 11 at 110,106,515 bp
  • T to C, chromosome 11 at 119,420,234 bp
  • G to A, chromosome 12 at 35,947,859 bp
  • T to C, chromosome 12 at 57,737,668 bp
  • G to A, chromosome 12 at 80,173,022 bp
  • T to C, chromosome 12 at 86,514,500 bp
  • A to T, chromosome 12 at 98,234,304 bp
  • A to T, chromosome 13 at 59,702,433 bp
  • T to A, chromosome 13 at 74,671,381 bp
  • C to T, chromosome 13 at 104,312,777 bp
  • T to A, chromosome 14 at 47,290,283 bp
  • G to A, chromosome 14 at 63,819,317 bp
  • C to A, chromosome 15 at 12,150,387 bp
  • A to C, chromosome 15 at 39,506,986 bp
  • G to A, chromosome 15 at 47,949,950 bp
  • A to T, chromosome 15 at 66,615,259 bp
  • G to A, chromosome 15 at 76,049,543 bp
  • A to G, chromosome 15 at 78,335,211 bp
  • G to T, chromosome 15 at 89,126,675 bp
  • T to C, chromosome 16 at 16,424,056 bp
  • A to T, chromosome 16 at 23,930,671 bp
  • G to A, chromosome 16 at 35,856,760 bp
  • A to G, chromosome 16 at 44,727,028 bp
  • A to T, chromosome 16 at 55,927,796 bp
  • G to A, chromosome 16 at 94,231,343 bp
  • A to G, chromosome 17 at 25,088,865 bp
  • A to G, chromosome 18 at 20,264,842 bp
  • T to C, chromosome 18 at 31,583,489 bp
  • A to T, chromosome 18 at 64,462,118 bp
  • C to T, chromosome 19 at 4,865,455 bp
  • C to G, chromosome 19 at 10,861,698 bp
  • T to A, chromosome 19 at 13,585,614 bp
  • A to G, chromosome 19 at 22,711,907 bp
  • A to T, chromosome X at 170,675,877 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1619 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039656-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.