Strain Name:
Stock Number:
Citation ID:
Other Names:
R1619 (G1), C57BL/6J-MtgxR1619Btlr
Major Collection:

Gene Information

Name: endothelin 3
Synonyms: 114CH19, 114-CH19, tmgc48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13616
Homologene: 88
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: D16Jhu34, 410I21.SP6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 110948
VEGA: 16
Homologene: 37302
Name: cholinergic receptor, nicotinic, alpha polypeptide 5
Synonyms: Acra-5, Acra5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110835
Homologene: 55485
Name: platelet-derived growth factor, C polypeptide
Synonyms: 1110064L01Rik, PDGF-C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 54635
Homologene: 9423
Name: unc-51 like kinase 2
Synonyms: Unc51.2, A830085I22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 29869
Homologene: 5891
Name: nucleosome assembly protein 1-like 1
Synonyms: D10Ertd68e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 53605
VEGA: 10
Homologene: 129218
Name: jumonji domain containing 1C
Synonyms: D630035I23Rik, TRIP8, 5430433L24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 108829
Homologene: 3129
Name: FYVE, RhoGEF and PH domain containing 4
Synonyms: Frabin-alpha, Frabin-gamma, Frabin-beta, Frabin, 9330209B17Rik, ZFYVE6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224014
Homologene: 26727
Name: protein disulfide isomerase associated 3
Synonyms: ERp57, ERp60, ERp61, Grp58, Plca, PDI-Q2, PDI, Erp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14827
Homologene: 68454
Name: leucine rich repeat containing 2
Synonyms: 4933431K03Rik, 2400002D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74249
Homologene: 23454
Name: scribbled planar cell polarity
Synonyms: Crc, Scrb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105782
Homologene: 44228
Name: par-3 family cell polarity regulator
Synonyms: ASIP, Pard3a, D8Ertd580e, PAR-3, Par3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 93742
Homologene: 10489
Name: centrosomal protein 97
Synonyms: 4932439K18Rik, Lrriq2, 2810403B08Rik, E130116N02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74201
Homologene: 11579
Name: PHD finger protein 20-like 1
Synonyms: CGI-72, E130113K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239510
VEGA: 15
Homologene: 9341
Name: coiled-coil-helix-coiled-coil-helix domain containing 6
Synonyms: 1700021B03Rik, Micos25, 0710001P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66098
Homologene: 11920
Name: estrogen related receptor, beta
Synonyms: ERR2, ERRb, Err2, Estrrb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 26380
Homologene: 69108
Name: helicase with zinc finger domain
Synonyms: 9430093I07Rik, 3110078M01Rik, 9630002H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 78455
Homologene: 8918
Name: zinc finger RNA binding protein
Synonyms: C920030H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 22763
Homologene: 8009
Name: enhancer of polycomb homolog 2
Synonyms: D2Ertd694e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227867
Homologene: 32274
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, Ndrp, 4632404O06Rik, 2810004D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 83946
Homologene: 41209
Name: actinin, alpha 1
Synonyms: 3110023F10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 109711
VEGA: 12
Homologene: 55553
Name: ankyrin 3, epithelial
Synonyms: Ank-3, AnkG, Ankyrin-G, Ankyrin-3, 2900054D09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11735
Homologene: 56908
Name: receptor-associated protein of the synapse
Synonyms: rapsyn, Raps, Nraps, 43kDa acetylcholine receptor-associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19400
Homologene: 3708
Name: regulating synaptic membrane exocytosis 2
Synonyms: RIM2, 2810036I15Rik, Syt3-rs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 116838
VEGA: 15
Homologene: 81639
Name: solute carrier family 25, member 46
Synonyms: 1200007B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67453
VEGA: 18
Homologene: 14518
Name: cullin 5
Synonyms: 8430423K24Rik, 4921514I20Rik, VACM-1, C330021I08Rik, C030032G03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75717
Homologene: 2597
Name: endoplasmic reticulum aminopeptidase 1
Synonyms: PILSAP, Arts1, ERAAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 80898
VEGA: 13
Homologene: 56754
Name: SET domain containing 1A
Synonyms: KMT2F
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233904
Homologene: 52251
Name: anterior gradient 3
Synonyms: LOC380754, E030025L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 403205
Homologene: 45551
Name: chromodomain helicase DNA binding protein 1-like
Synonyms: 4432404A22Rik, Snf2p
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 68058
Homologene: 11590
Name: START domain containing 3
Synonyms: Mln64, es64
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 59045
Homologene: 38227
Name: nucleolus and neural progenitor protein
Synonyms: BC027231
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 212547
Homologene: 9127
Name: dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex)
Synonyms: PDC-E2, 6332404G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235339
Homologene: 6814
Name: dermatan sulfate epimerase
Synonyms: Sart2, B130024B19Rik, DS-epi1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 212898
VEGA: 10
Homologene: 8354
Name: zinc finger protein 940
Synonyms: BC027344
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233057
Homologene: 138421
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 171395
Homologene: 51376
Name: sushi domain containing 2
Synonyms: 1200011D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 71733
VEGA: 10
Homologene: 10481
Name: glutamate receptor, metabotropic 2
Synonyms: Gprc1b, mGluR2, 4930441L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 108068
Homologene: 20229
Name: NOBOX oogenesis homeobox
Synonyms: Og2x
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18291
Homologene: 51066
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: D930026N18Rik, (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12288
Homologene: 55484
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6
Synonyms: ADAM-TS6, b2b2228Clo, b2b2029Clo, b2b2182Clo, b2b2187.1Clo, b2b1879.1Clo, A930019D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 108154
VEGA: 13
Homologene: 82573
Name: transient receptor potential cation channel, subfamily M, member 3
Synonyms: LTRPC3, MLSN2, melastatin 2, B930001P07Rik, 6330504P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226025
VEGA: 19
Homologene: 62287
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 672511
Homologene: 45439
Name: olfactory receptor 1484
Synonyms: MOR202-37, GA_x6K02T2RE5P-3917859-3918806
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258288
Homologene: 110492
Name: inturned planar cell polarity protein
Synonyms: 9430087H23Rik, 9230116I04Rik, Pdzd6, Pdzk6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 380614
Homologene: 41059
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94217
Homologene: 56810
Name: protocadherin 10
Synonyms: 6430521D13Rik, OL-pc, 6430703F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18526
Homologene: 74967
Name: carboxylesterase 2G
Synonyms: 2210023G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72361
Homologene: 77154
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 11
Synonyms: Bsep, ABC16, sister of P-glycoprotein, PGY4, Lith1, PFIC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27413
Homologene: 74509
Name: collagen, type XIX, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12823
Homologene: 55608
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239420
Homologene: 65982
Name: ATP-binding cassette, sub-family A (ABC1), member 9
Synonyms: D630040K07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217262
Homologene: 33332
Name: GUF1 homolog, GTPase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231279
Homologene: 6505
Name: olfactory receptor 1281
Synonyms: MOR248-14P, MOR248-18, GA_x6K02T2Q125-72379864-72380781
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 257979
Homologene: 73992
Name: regulatory factor X, 6
Synonyms: Rfxdc1, 4930572O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 320995
Homologene: 18318
Name: RIPOR family member 3
Synonyms: Fam65c, 2310033K02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 69553
Homologene: 15438
Name: pregnancy-associated plasma protein A
Synonyms: 8430414N03Rik, IGFBP-4ase, PAPP-A, PAG1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18491
Homologene: 31097
Name: glycerol-3-phosphate acyltransferase 2, mitochondrial
Synonyms: A530057A03Rik, Gpat2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 215456
Homologene: 19037
Name: intraflagellar transport 140
Synonyms: Wdtc2, Tce5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106633
Homologene: 40979
Name: collagen, type XVI, alpha 1
Synonyms: A530052M23Rik, 2700007F12Rik, [a]1 (XVI) collagen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 107581
Homologene: 1397
Name: actinin alpha 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 11474
Homologene: 862
Name: netrin 4
Synonyms: beta-netrin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 57764
Homologene: 10934
Name: glutamate receptor, ionotropic, delta 2
Synonyms: GluRdelta2, tpr, B230104L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14804
Homologene: 74399
Name: colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Synonyms: beta c, Csf2rb1, Bc, AIC2B, Il3r, CDw131, common beta chain, Il3rb1, Il5rb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12983
VEGA: 15
Homologene: 339
Name: homeodomain interacting protein kinase 3
Synonyms: DYRK6, FIST3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 15259
Homologene: 55923
Name: kinesin family member 26B
Synonyms: N-11 kinesin, D230039L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269152
Homologene: 18623
Name: desmoglein 1 gamma
Synonyms: Dsg6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 211924
Name: X-linked Kx blood group related 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219149
Homologene: 18287
Name: coiled-coil domain containing 42
Synonyms: A530001H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276920
Homologene: 44902
Name: cholecystokinin A receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12425
Homologene: 37337
Name: dystrophia myotonica-containing WD repeat motif
Synonyms: 59, Dm9, DMR-N9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13401
Homologene: 22559
Name: solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Synonyms: 4933424B12Rik, 4933425K02Rik, Nhedc1, 1700094G20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74446
Homologene: 49914
Name: RIKEN cDNA D630004N19 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Name: tripartite motif-containing 62
Synonyms: 6330414G21Rik, Dear1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67525
Homologene: 10071
Name: secretoglobin, family 2B, member 27
Synonyms: Scgb2b5, Abpbg27, C2a, Abpb, Abpbg5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233099
Homologene: 83171
Name: galactosylceramidase
Synonyms: Gacy, 2310068B06Rik, A930008M05Rik, galactocerebrosidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 14420
VEGA: 12
Homologene: 124
Name: histone deacetylase 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 170787
Homologene: 23749
Name: suppressor of cytokine signaling 4
Synonyms: Socs7, A730004F22Rik, 3110032M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67296
Homologene: 15442
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: CoaSt6, 1600029O10Rik, collaborator of Stat6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 547253
Homologene: 19697
Name: actin, gamma 2, smooth muscle, enteric
Synonyms: Acta3, Act4, Act-4, SMGA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11468
Homologene: 123845
Name: chymotrypsin-like elastase family, member 2A
Synonyms: Ela2, Ela2a, Ela-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13706
Homologene: 40598
Name: olfactory receptor 385
Synonyms: GA_x6K02T2P1NL-3760313-3759375, MOR135-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 259025
Homologene: 133670
Name: disco interacting protein 2 homolog A
Synonyms: Kiaa0184-hp, Dip2, 4931420H10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 64451
Homologene: 41012
Name: tetratricopeptide repeat domain 4
Synonyms: 2810002P21Rik, L62
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 72354
Homologene: 31249
Name: beta-carotene oxygenase 1
Synonyms: Bcdo1, Bcdo, Cmoi, beta-CD, Bcmo1, betaCMOOX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 63857
Homologene: 41172
Name: olfactory receptor 644
Synonyms: GA_x6K02T2PBJ9-6803062-6802118, MOR13-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259125
Homologene: 17491
Name: olfactory receptor 823
Synonyms: MOR210-4, GA_x6K02T2PULF-11783479-11782532
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258668
Homologene: 45026
Name: cDNA sequence BC051019
Synonyms: D7H11orf16, ICRFP703N2430Q5.5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57355
Homologene: 49631
Name: ATP-binding cassette, sub-family A (ABC1), member 7
Synonyms: Abc51
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 27403
Homologene: 22783
Name: transmembrane protein 132A
Synonyms: Hspa5bp1, 6720481D13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 98170
Homologene: 75076
Name: tolloid-like
Synonyms: b2b2476Clo, Tll-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 21892
Homologene: 49202
Name: olfactory receptor 71
Synonyms: mOR17, MOR262-4, GA_x6K02T2N78B-16230286-16231224
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56015
Homologene: 10460
Name: Na+/K+ transporting ATPase interacting 4
Synonyms: C030019F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 58237
Homologene: 10978
Name: ferrochelatase
Synonyms: fch, Fcl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 14151
VEGA: 18
Homologene: 113
Name: RIKEN cDNA 4921506M07 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 2
Synonyms: Clg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101497
Homologene: 16341
Name: receptor transporter protein 2
Synonyms: LOC224055
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224055
VEGA: 16
Homologene: 19503
Name: major urinary protein 9
Synonyms: Gm14076
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100038948
Homologene: 74304
Name: vomeronasal 2, receptor 38
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 434110
Homologene: 113703
Name: SRC kinase signaling inhibitor 1
Synonyms: p140Cap, P140
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56013
Homologene: 10324
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 24,534,091 bp
  • A to G, chromosome 1 at 178,916,478 bp
  • A to G, chromosome 2 at 40,697,589 bp
  • G to A, chromosome 2 at 49,549,978 bp
  • G to A, chromosome 2 at 69,286,661 bp
  • A to G, chromosome 2 at 91,043,159 bp
  • A to T, chromosome 2 at 104,434,502 bp
  • A to G, chromosome 2 at 111,328,961 bp
  • G to A, chromosome 2 at 121,432,377 bp
  • A to G, chromosome 2 at 127,428,717 bp
  • T to C, chromosome 2 at 167,980,845 bp
  • A to T, chromosome 2 at 174,779,765 bp
  • A to G, chromosome 2 at 180,936,001 bp
  • T to A, chromosome 3 at 40,697,631 bp
  • A to G, chromosome 3 at 45,380,312 bp
  • T to C, chromosome 3 at 81,174,887 bp
  • C to T, chromosome 3 at 97,582,731 bp
  • A to G, chromosome 3 at 135,355,004 bp
  • A to G, chromosome 4 at 43,706,292 bp
  • A to G, chromosome 4 at 60,421,879 bp
  • A to G, chromosome 4 at 65,176,229 bp
  • A to G, chromosome 4 at 106,665,646 bp
  • A to G, chromosome 4 at 128,909,488 bp
  • G to A, chromosome 4 at 130,098,940 bp
  • A to G, chromosome 4 at 141,825,941 bp
  • A to T, chromosome 5 at 53,700,067 bp
  • A to G, chromosome 5 at 69,559,639 bp
  • A to T, chromosome 6 at 43,307,467 bp
  • G to A, chromosome 6 at 64,094,448 bp
  • T to A, chromosome 6 at 83,523,187 bp
  • G to T, chromosome 6 at 89,419,754 bp
  • C to T, chromosome 6 at 118,612,625 bp
  • C to A, chromosome 7 at 9,075,533 bp
  • TAGCCTGGGAA to TAGCCTGGGAAGCCTGGGAA, chromosome 7 at 19,081,034 bp
  • T to C, chromosome 7 at 28,368,421 bp
  • G to A, chromosome 7 at 29,845,537 bp
  • A to T, chromosome 7 at 34,012,132 bp
  • G to A, chromosome 7 at 100,546,275 bp
  • T to C, chromosome 7 at 104,068,531 bp
  • T to A, chromosome 7 at 109,718,062 bp
  • T to A, chromosome 7 at 127,784,837 bp
  • C to A, chromosome 8 at 64,056,273 bp
  • A to T, chromosome 8 at 104,967,352 bp
  • T to C, chromosome 8 at 117,108,715 bp
  • C to A, chromosome 8 at 127,380,502 bp
  • A to T, chromosome 9 at 50,640,352 bp
  • G to T, chromosome 9 at 53,658,593 bp
  • A to G, chromosome 9 at 55,004,365 bp
  • A to T, chromosome 9 at 82,871,449 bp
  • T to A, chromosome 9 at 106,647,471 bp
  • T to A, chromosome 9 at 110,960,973 bp
  • T to C, chromosome 10 at 34,153,234 bp
  • A to T, chromosome 10 at 51,722,994 bp
  • T to C, chromosome 10 at 67,219,875 bp
  • T to C, chromosome 10 at 69,879,975 bp
  • G to T, chromosome 10 at 75,638,044 bp
  • A to T, chromosome 10 at 76,286,350 bp
  • A to T, chromosome 10 at 80,009,055 bp
  • C to A, chromosome 10 at 93,644,734 bp
  • G to A, chromosome 10 at 111,493,379 bp
  • A to G, chromosome 10 at 130,112,679 bp
  • A to G, chromosome 11 at 8,950,413 bp
  • A to T, chromosome 11 at 61,781,746 bp
  • A to G, chromosome 11 at 68,594,289 bp
  • A to T, chromosome 11 at 73,589,292 bp
  • A to G, chromosome 11 at 97,525,481 bp
  • T to A, chromosome 11 at 98,376,609 bp
  • T to A, chromosome 11 at 107,636,279 bp
  • T to A, chromosome 11 at 110,106,515 bp
  • T to C, chromosome 11 at 119,420,234 bp
  • G to A, chromosome 12 at 35,947,859 bp
  • T to C, chromosome 12 at 57,737,668 bp
  • G to A, chromosome 12 at 80,173,022 bp
  • T to C, chromosome 12 at 86,514,500 bp
  • A to T, chromosome 12 at 98,234,304 bp
  • A to T, chromosome 13 at 59,702,433 bp
  • T to A, chromosome 13 at 74,671,381 bp
  • C to T, chromosome 13 at 104,312,777 bp
  • T to A, chromosome 14 at 47,290,283 bp
  • G to A, chromosome 14 at 63,819,317 bp
  • C to A, chromosome 15 at 12,150,387 bp
  • A to C, chromosome 15 at 39,506,986 bp
  • G to A, chromosome 15 at 47,949,950 bp
  • A to T, chromosome 15 at 66,615,259 bp
  • G to A, chromosome 15 at 76,049,543 bp
  • A to G, chromosome 15 at 78,335,211 bp
  • G to T, chromosome 15 at 89,126,675 bp
  • T to C, chromosome 16 at 16,424,056 bp
  • A to T, chromosome 16 at 23,930,671 bp
  • G to A, chromosome 16 at 35,856,760 bp
  • A to G, chromosome 16 at 44,727,028 bp
  • A to T, chromosome 16 at 55,927,796 bp
  • G to A, chromosome 16 at 94,231,343 bp
  • A to G, chromosome 17 at 25,088,865 bp
  • A to G, chromosome 18 at 20,264,842 bp
  • T to C, chromosome 18 at 31,583,489 bp
  • A to T, chromosome 18 at 64,462,118 bp
  • C to T, chromosome 19 at 4,865,455 bp
  • C to G, chromosome 19 at 10,861,698 bp
  • T to A, chromosome 19 at 13,585,614 bp
  • A to G, chromosome 19 at 22,711,907 bp
  • A to T, chromosome X at 170,675,877 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1619 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039656-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.